Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser.

Freelancer

AdvertiseWithUs

All site questions

  • Anjana
    512 days ago
    Questions (1)

    I am using this perl code right nowadays.

    #!/usr/bin/perl use warnings; use strict;
    open(FASTA, "<", seq.fa) or die("Can't open\n"); my %singleLineSequences; my $sequence_id; while(){ my $line = $_; chomp($line); if ($line =~ m/^>(\S+)/){ $sequence_id = $1;
    $singleLineSequences{$sequence_id} = ""; } else { $singleLineSequences{$sequence_id} = $singleLineSequences{$sequence_id} . $line; } }

    foreach my $sequence_entry (keys %singleLineSequences){ my $currentSequence = $singleLineSequences{$sequence_entry}; my $lengthSequence = length($currentSequence); print $sequence_entry . "," . $lengthSequence . "\n"; }
  • Shruti Paniwala
    522 days ago
    Questions (1)

    I am doing megablast of a contig against NR database, but unable to understand this

    -outfmt '6 qseqid staxids qstart qend sstart send qseq sseq evalue length'

    Can you please help me to undestand all these.

  • Nishi Singh
    548 days ago
    Questions (3)

    Until there is a radical change in the way that academic credit is given, the principal record of scientific research is still the peer-reviewed publication. Given that software is a fundamental part of doing science in the digital age, the question we are often asked is: where can I publish papers which are primarily focused on my scientific software?

  • Anjana
    572 days ago
    Questions (3)

    Is there any database exists which provides RNAseq data for different cancers stages?

  • Jit
    597 days ago
    Questions (1)

    I run SatsumaSynteny on my server using following command:

    [jit@hm satsuma-code-0]$ ./SatsumaSynteny -q Genome/renamedG.fa -t Genome/genome_v4.fasta -o Genome/OutFile -m 128 -ni 10 -n 256 -chain_only

    But it kill the program with followng error: 

    ./SatsumaSynteny: /lib64/libc.so.6: version `GLIBC_2.14' not found (required by ./SatsumaSynteny)

    Can anyone please help to resolve this.

    My server detail:

    [jit@hm satsuma-code-0]$ lscpu
    Architecture: x86_64
    CPU op-mode(s): 32-bit, 64-bit
    Byte Order: Little Endian
    CPU(s): 12
    On-line CPU(s) list: 0-11
    Thread(s) per core: 1
    Core(s) per socket: 6
    Socket(s): 2
    NUMA node(s): 2
    Vendor ID: AuthenticAMD
    CPU family: 16
    Model: 8
    Stepping: 1
    CPU MHz: 2600.186
    BogoMIPS: 5200.03
    Virtualization: AMD-V
    L1d cache: 64K
    L1i cache: 64K
    L2 cache: 512K
    L3 cache: 5118K
    NUMA node0 CPU(s): 0,2-6
    NUMA node1 CPU(s): 1,7-11

  • Priya Singh
    609 days ago
    Questions (2)

    Is there any easiest known way to extract organism's chromosome length?

  • Poonam Mahapatra
    611 days ago
    Questions (1)

    I received a new genome to annotated. I need your help to quickly count the occurance of all the letters in fasta file.

  • Nadia Baig
    615 days ago
    Questions (2)

    i have downloaded sra file and converted into paired end FastQ having following headers:

    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAT

    The head and tail of file are as follow

    Head:

    ==> ERR042057_1.fastq <==
    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    TNACTGTTTCTCTAAAACCTTACAAGAAAAACTAAGCTTCTCTAAACTTGTATTCATTATGGGAGNATGNCA
    +HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    C)CCCGGGGGIIIIIIIIIIIIIHIIIIIIIIIIIGIHIIIIIHHIIIHIHIIHIIHIIHAAA?B#######
    @HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    ANGTTGTCTAAAGTAATAACTCCATTGGCTATTATTTTCTAAACATCTAAAACAAAACTTAACTANCGANAT
    +HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    B(B?BGGGGGIIIICIIIIIIIIIIIIIIIIHIHIIIIIIIIIIIIGIIIIIIFIIIIGIEEECE#######
    @HWUSI-EAS754_0001:4:1:6654:1035#GCCAAT
    TNTTTAAATAAAAGGTTCTGTATCTTGATCCTGAAGTATCCTGTAATAGCCTACAGTGAAAAGAANACANTT

    ==> ERR042057_2.fastq <==
    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    AAGAAATTTATTCCTGCAGATCAATATTTCCCGCAACCACTTGAGAATTTCTGTGCTACTAAGCATTTGATG
    +HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    IIHHHIIIIHIHIIHGIIIIIIGIHGGG4D<??:@CC?C@CGEDFGEEEEGH>EH<BEEFED8CFBEBEB?#
    @HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    AGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGCTCAGGTGCTTTTGGAACGGTTTATAAAGTAAGTAAAAA
    +HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    HHGHHHHHHHHHHHHHFHHHHHHFFHEHHHGHGH<DBDB=DDDDDBFCDEB><BB>CBDB=D?BE?8A?A37
    @HWUSI-EAS754_0001:4:1:6654:1035#GCCAAT
    CTAAACCCCCCCCCACCCCACCCCCCCACCACACCAACCCCACCCACACACCCCAACCACCCTCACACTCTC



    Tail:

    ==> ERR042057_1.fastq <==
    +HWUSI-EAS754_0001:4:120:19005:21176#GCCAAT
    G>D>DBDDGBGGE@>EGGGGBG;GGGGDBG##########################################
    @HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    GAGAAAGAATTCAAACTGATTTTTCTTTTCTTNNNNNNNNNNNNGGGCACTNNNNNNNNNNNTGGCCCTCCT
    +HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    IIIEIIIHIIIHIIIIIIEIHIIIIHHIII##########################################
    @HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    CGGGGAAGAGCGCCAGCACCGAGGTGCCAGGTNNNNNNNNNNNNGCGGAGAANNNNNNNNNNATCATGCAGT
    +HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    HIGIIHIIIIIIIHDIIHIIGGII@DD?BD##########################################

    ==> ERR042057_2.fastq <==
    +HWUSI-EAS754_0001:4:120:19005:21176#GCCAAT
    ?AA6A?A?A?A@@<A#########################################################
    @HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    ATTAGCAGACATATATCTTTTCTCTGAAATCTAAATACTTGCAGAAATACTAATTTTCATTTTATATTATGT
    +HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    HGHHFFEHEHHHFHHBDBH:DGGGEHFBHHHDGHHHDHDHBGGGEGGEGGGBGGG(+:;;F<=F@;FE?EGG
    @HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    CAAAGCAGGCCCCACGAGGCTGGCTGCGTGCGGGGTGCTCACCCGTGGCCGGTCCTGCGGGGCCCGCTGATC
    +HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    HFHHHHHHEHHHHHHA3E8GD>GGBBEEBEGG<G>?AD>GGGEEGD>G@DGD3D##################

     

     

     

    How to determine the @RG ?

     

    I'm using the following command to add @RG tag:

    java -jar picard.jar AddOrReplaceReadGroups I=input.bam O=output.bam RGID=? RGLB=? RGPL=illumina RGPU=? RGSM=?

     

     

    What should be the @RG tags values for following parameters:

    RGID=?

    RGLB=?

    RGPL=illumina

    RGPU=?

    RGSM=?

    The link for SRA data is :

    http://www.ncbi.nlm.nih.gov/sra/ERX019190[accn

     

     

    Thankyou in advance

     

  • Nadia Baig
    624 days ago
    Questions (2)

    Iam searching for the exome data for an eye disease "Glaucoma" obtained by next generation sequencing platform but unfortunately  i am not able to get that data. I have already searched ncbi SRC, GEO data sets of ncbi but no data is available. Is there any database other than these to get data in FASTQC format?? Or any article related to glaucoma where information about datasets is available.

    thanks