Our Sponsors



Download BioinformaticsOnline(BOL) Apps in your chrome browser. BOLChromeApps

Freelancer

AdvertiseWithUs

All site questions

  • Priya Singh
    484 days ago
    Questions (2)

    Is there any easiest known way to extract organism's chromosome length?

  • Poonam Mahapatra
    486 days ago
    Questions (1)

    I received a new genome to annotated. I need your help to quickly count the occurance of all the letters in fasta file.

  • Nadia Baig
    490 days ago
    Questions (2)

    i have downloaded sra file and converted into paired end FastQ having following headers:

    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAT

    The head and tail of file are as follow

    Head:

    ==> ERR042057_1.fastq <==
    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    TNACTGTTTCTCTAAAACCTTACAAGAAAAACTAAGCTTCTCTAAACTTGTATTCATTATGGGAGNATGNCA
    +HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    C)CCCGGGGGIIIIIIIIIIIIIHIIIIIIIIIIIGIHIIIIIHHIIIHIHIIHIIHIIHAAA?B#######
    @HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    ANGTTGTCTAAAGTAATAACTCCATTGGCTATTATTTTCTAAACATCTAAAACAAAACTTAACTANCGANAT
    +HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    B(B?BGGGGGIIIICIIIIIIIIIIIIIIIIHIHIIIIIIIIIIIIGIIIIIIFIIIIGIEEECE#######
    @HWUSI-EAS754_0001:4:1:6654:1035#GCCAAT
    TNTTTAAATAAAAGGTTCTGTATCTTGATCCTGAAGTATCCTGTAATAGCCTACAGTGAAAAGAANACANTT

    ==> ERR042057_2.fastq <==
    @HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    AAGAAATTTATTCCTGCAGATCAATATTTCCCGCAACCACTTGAGAATTTCTGTGCTACTAAGCATTTGATG
    +HWUSI-EAS754_0001:4:1:5605:1034#GCCAAT
    IIHHHIIIIHIHIIHGIIIIIIGIHGGG4D<??:@CC?C@CGEDFGEEEEGH>EH<BEEFED8CFBEBEB?#
    @HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    AGAAACTGAGCTGAAGAGGGTAAAAGTCCTTGGCTCAGGTGCTTTTGGAACGGTTTATAAAGTAAGTAAAAA
    +HWUSI-EAS754_0001:4:1:6122:1035#GCCAAT
    HHGHHHHHHHHHHHHHFHHHHHHFFHEHHHGHGH<DBDB=DDDDDBFCDEB><BB>CBDB=D?BE?8A?A37
    @HWUSI-EAS754_0001:4:1:6654:1035#GCCAAT
    CTAAACCCCCCCCCACCCCACCCCCCCACCACACCAACCCCACCCACACACCCCAACCACCCTCACACTCTC



    Tail:

    ==> ERR042057_1.fastq <==
    +HWUSI-EAS754_0001:4:120:19005:21176#GCCAAT
    G>D>DBDDGBGGE@>EGGGGBG;GGGGDBG##########################################
    @HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    GAGAAAGAATTCAAACTGATTTTTCTTTTCTTNNNNNNNNNNNNGGGCACTNNNNNNNNNNNTGGCCCTCCT
    +HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    IIIEIIIHIIIHIIIIIIEIHIIIIHHIII##########################################
    @HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    CGGGGAAGAGCGCCAGCACCGAGGTGCCAGGTNNNNNNNNNNNNGCGGAGAANNNNNNNNNNATCATGCAGT
    +HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    HIGIIHIIIIIIIHDIIHIIGGII@DD?BD##########################################

    ==> ERR042057_2.fastq <==
    +HWUSI-EAS754_0001:4:120:19005:21176#GCCAAT
    ?AA6A?A?A?A@@<A#########################################################
    @HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    ATTAGCAGACATATATCTTTTCTCTGAAATCTAAATACTTGCAGAAATACTAATTTTCATTTTATATTATGT
    +HWUSI-EAS754_0001:4:120:19024:21176#GCCAAT
    HGHHFFEHEHHHFHHBDBH:DGGGEHFBHHHDGHHHDHDHBGGGEGGEGGGBGGG(+:;;F<=F@;FE?EGG
    @HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    CAAAGCAGGCCCCACGAGGCTGGCTGCGTGCGGGGTGCTCACCCGTGGCCGGTCCTGCGGGGCCCGCTGATC
    +HWUSI-EAS754_0001:4:120:19130:21175#GCCAAT
    HFHHHHHHEHHHHHHA3E8GD>GGBBEEBEGG<G>?AD>GGGEEGD>G@DGD3D##################

     

     

     

    How to determine the @RG ?

     

    I'm using the following command to add @RG tag:

    java -jar picard.jar AddOrReplaceReadGroups I=input.bam O=output.bam RGID=? RGLB=? RGPL=illumina RGPU=? RGSM=?

     

     

    What should be the @RG tags values for following parameters:

    RGID=?

    RGLB=?

    RGPL=illumina

    RGPU=?

    RGSM=?

    The link for SRA data is :

    http://www.ncbi.nlm.nih.gov/sra/ERX019190[accn

     

     

    Thankyou in advance

     

  • Nadia Baig
    499 days ago
    Questions (2)

    Iam searching for the exome data for an eye disease "Glaucoma" obtained by next generation sequencing platform but unfortunately  i am not able to get that data. I have already searched ncbi SRC, GEO data sets of ncbi but no data is available. Is there any database other than these to get data in FASTQC format?? Or any article related to glaucoma where information about datasets is available.

    thanks

  • pradyumna Jayaram
    501 days ago
    Questions (1)

    There are many mapping tools, and each one has its own specifications. Once we have two or more tools for similar purposes, how can we say which tool is better?

  • Gudiya Pal
    505 days ago
    Questions (2)

    I am currently dealing with new contig assembly dataset, and bit confused about N50 and L50 stuff ....

  • Amala Arumugam
    513 days ago
    Questions (1)

    Can anyone tell me how to rectify the problem in Sift ? While am running the fasta sequence of my protein of interest its showing error after few minutes and  few times it giving job id but am not getting the result

  • karimse07
    546 days ago
    Questions (0)

    where can i find a bioinformatics study partner online , to discuss , work toghether in the field