BOL

I am problem installing Perl module on cluster/server without root. Can you please recommend me a easy way or alternative way to install it.

I am looking for new, interactive and user friendly tools to see chromosomal rearrangements. I tried IGV, but it does not seems to be very helpful for chromosomal rearrangements visualization. Circos look pretty useless, as it does not allow me to explore well. Help Please...

Extract "Seq2" from the list below

>Seq1
GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTC
CTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGAT
TGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCAT
GCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGT
TGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTA
CGCTGAGCATTATCGAAAGAAAGAAGAAGT
>Seq2
CAGGGCCAGCGCCGCCGACAGGCCGGTGAAGCCGCCGCCGA
CGATGGCCACGTCCACCTGCGCCGGCAGGTCTTGCGACCGCG
GCACGAAGGCGGGGGCGGAATCGGTCCAGTACGGGTCGAGCT
TCATGGCGGCGGCGAGGGGCGGGAAGGGCAGCGTTCGATCAG
GGGCCGGGGTTCAGAGACCCACCACGCCGGGCAGGCCGCCGA
TGTCCTGGATCTCGACATAGCGATAGGCCGGGTTGCCCGGGC

I want to publish my research work on miRNA. I used online "freely" available miRNA dataset, with not known publications, and analysed it. Can you please suggest your experience publishing it in a good Impact Factor Journal? Is this possible to published it? 

I got the following error while running MizBee.How to fiw it.

./MizBee                                    []
OpenJDK 64-Bit Server VM warning: You have loaded library /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so which might have disabled stack guard. The VM will try to fix the stack guard now.
It's highly recommended that you fix the library with 'execstack -c ', or link it with '-z noexecstack'.
Exception in thread "Animation Thread" java.lang.UnsatisfiedLinkError: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: wrong ELF class: ELFCLASS32 (Possible cause: architecture word width mismatch)
    at java.lang.ClassLoader$NativeLibrary.load(Native Method)
    at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1941)
    at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1857)
    at java.lang.Runtime.loadLibrary0(Runtime.java:870)
    at java.lang.System.loadLibrary(System.java:1122)
    at com.sun.gluegen.runtime.NativeLibLoader.loadLibraryInternal(NativeLibLoader.java:102)
    at com.sun.gluegen.runtime.NativeLibLoader.access$000(NativeLibLoader.java:51)
    at com.sun.gluegen.runtime.NativeLibLoader$1.run(NativeLibLoader.java:70)
    at java.security.AccessController.doPrivileged(Native Method)
    at com.sun.gluegen.runtime.NativeLibLoader.loadGlueGenRT(NativeLibLoader.java:68)
    at com.sun.gluegen.runtime.NativeLibrary.ensureNativeLibLoaded(NativeLibrary.java:399)
    at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:163)
    at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:129)
    at com.sun.opengl.impl.x11.DRIHack.begin(DRIHack.java:109)
    at com.sun.opengl.impl.x11.X11GLDrawableFactory.(X11GLDrawableFactory.java:99)
    at java.lang.Class.forName0(Native Method)
    at java.lang.Class.forName(Class.java:264)
    at javax.media.opengl.GLDrawableFactory.getFactory(GLDrawableFactory.java:111)
    at processing.opengl.PGraphicsOpenGL.allocate(PGraphicsOpenGL.java:173)
    at processing.core.PGraphics3D.setSize(PGraphics3D.java:323)
    at processing.core.PApplet.makeGraphics(PApplet.java:1321)
    at processing.core.PApplet.size(PApplet.java:1142)
    at processing.core.PApplet.size(PApplet.java:1102)
    at MizBee.setup(MizBee.java:87)
    at processing.core.PApplet.handleDraw(PApplet.java:1571)
    at processing.core.PApplet.run(PApplet.java:1496)
    at java.lang.Thread.run(Thread.java:745)

I tried SyMAP but got the following error 

$ ./symap []

Starting SyMAP v4.2 - Project Manager
SyMAP Version v4.2
Java Version 1.8.0_91, mem: 1820M
Build 116
Reading from file symap.config
The built-in MySQL server cannot run because a MySQL server is already running on this computer.
Please stop that server, or else specify a MySQL host name in the symap.config file.

If i have a set of miRNA sequences, what are the tools that are available to predict the target genes? I tried miRanda and mirdb, are there any  tools or databases that do the same, as the rna is not already known i cant use targetscan etc. The tool must predict the target from the fasta sequence of miRNA.

Thank you

I am trying to merge contigs, generated from different assemblies with MeGAMerge, but it failed after running few hour !! Following are the error I got on command prompt. Any suggestions??

perl MeGAMerge-1.1.pl -f MergedDIR allContigs_MIRA_assembled.fa
Running Newbler assembly with 308261 sequences
runAssembly -force -large -rip -mi 98 -ml 80 -pairt -cpu 4 -a 200 -o MergedDIR/newbler MergedDIR/newblerIn.fasta 1>/dev/null 2>/dev/null
Running Minimus2 with 331388 sequences
minimus2 -D CONSERR=0.06 -D MINID=98 -D OVERLAP=80 MergedDIR/minimus.fasta 1>/dev/null 2>/dev/null
minimus2 -D CONSERR=0.06 -D MINID=98 -D OVERLAP=80 MergedDIR/minimus.fasta 1>/dev/null 2>/dev/null failed:
Died at MeGAMerge-1.1.pl line 283.

make[3]: Entering directory '/home/dept/Tools/amos-3.1.0/src/Align'
g++ -DHAVE_CONFIG_H -I. -I../..  -I../../src/CelMsg -I../../src/Slice -I../../src/Common -I../../src/AMOS -I../../src/GNU -I../../src/Foundation   -g -O2 -MT find-tandem.o -MD -MP -MF .deps/find-tandem.Tpo -c -o find-tandem.o find-tandem.cc
find-tandem.cc: In function ‘int main(int, char**)’:
find-tandem.cc:243:3: error: ‘optarg’ was not declared in this scope
   optarg = NULL;
   ^
find-tandem.cc:245:63: error: ‘getopt’ was not declared in this scope
   while (!errflg && ((ch = getopt (argc, argv, "f:u:l:x:m:k:h")) != EOF))
                                                               ^
find-tandem.cc:258:55: error: ‘optopt’ was not declared in this scope
         fprintf (stderr, "Unrecognized option -%c\n", optopt);
                                                       ^
Makefile:918: recipe for target 'find-tandem.o' failed
make[3]: *** [find-tandem.o] Error 1
make[3]: Leaving directory '/home/urbe/Tools/amos-3.1.0/src/Align'
Makefile:325: recipe for target 'all-recursive' failed
make[2]: *** [all-recursive] Error 1
make[2]: Leaving directory '/home/urbe/Tools/amos-3.1.0/src'
Makefile:306: recipe for target 'all-recursive' failed
make[1]: *** [all-recursive] Error 1
make[1]: Leaving directory '/home/urbe/Tools/amos-3.1.0'
Makefile:244: recipe for target 'all' failed
make: *** [all] Error 2

Using breakdancer the output consists of DEL, INV, INS, CTX and ITX. Using following commands:

bam2cfg.pl -g -h dis.bam normal.bam > config_file.cfg
breakdancer_max -d test config_file.cfg > dis_normal.ctx

the 11th output column should displays the amount of reads supporting the called SV per bam-file. I have some unusual research in 11th column, can you please helpme to fix it.