BBTools for bioinformatician !
...Code: ACCGTTACCGTTACCGTTAC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be pretty obvious. Convert SAM format from 1.4 to 1.3 (r...2234 days ago
2123 days ago
Install ImageMagick from Unix Source
...dy to use ImageMagick to convert, compose, or edit your i...nts... 1572864checking how to convert x86_64-pc-linux-gnu file name...m... /bin/rmchecking for rsvg-convert... rsvg-convertchecking for i...c -m 644 ./www/api/MagickWand/convert_8c.html /usr/local/share/doc/...2109 days ago
Converting a VCF into a FASTA given some reference !
...es a Perl script vcfutils.pl which does this, the function vcf2fq (lines 469-528) This script has been modified by others to convert InDels as well, e.g. thi...2079 days ago