Results for "Convert"
Blogs
BBTools for bioinformatician !
...Code: ACCGTTACCGTTACCGTTAC 100 AAATTTTTTTCCCCCCCCCC 85 ...etc. If the primers are 20bp long, they should be pretty obvious. Convert SAM format from 1.4 to 1.3 (r...2255 days ago
- ...s to the same reference build. LiftOver can have three use cases: (1) Convert genome position from one geno...C hg 18) and hope to lift them over to NCBI build 37 (UCSC hg19). (2) Convert dbSNP rs number from one buil...
2144 days ago
- +2 more Blogs
Bookmarks
- ...enome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between sp...
2993 days ago
- ...ows platforms. Currently CSBB provides 13 modules focused on analytical tasks like performing upper-quantile normalization on expression data or convert genome wide gene expression t...
2851 days ago
- +13 more Bookmarks
Files
- ...429.488 sec[E::hts_open_format] Failed to open file temporarySamsamtools sort: can't open "temporarySam": No such file or directory[bwa_aln_core] convert to sequence coordinate... 1.0...
2135 days ago
Pages
Bio++ : C Language libraries for your biological need
...as possible, and retain its spirit and efficiency. It was possible to convert from C to C++ gradually, thus...d names, testing existence, open and store in string arrays, etc.Text: convert text to any other type and vi...3932 days ago
Genome Assembly Tools and Software - PART2 !!
...p Assembly problemATLAS GapFill deals with the repetitive gap assembly problem by using the unique gap-flanking sequences to group reads and convert the problem to a local assemb...2670 days ago
- +3 more Pages
Top-level pages
Perl one-liner for bioinformatician !!!
...spacing, numbering lines, doing calculations, converting and substituting text, del...00, 105, 110, 103); print pack("C*", @ascii)'#converts ascii values into character...)/\u$1/g' #Camel Casingperl -pe 's|\n|\r\n|' #Convert unix new lines into DOS new l...3612 days ago
- ...ckage. It is a multipurpose tool designed for converting reads or other nucleotide...different formats. It supports, and can inter-convert: fastq fasta fasta+qual sam...namimg conventions: reformat.sh in=x.fq vint Convert ASCII-33 to ASCII-64: reforma...
2698 days ago
- +8 more Top-level pages
Wire posts
Opportunity posts
SRF/JRF Bioinformatics at CIARI
...ands. The ultimate aim of CIARI is the developments of island agricultural production technologies which utilizes the strengths of the island and convert the constraints in opportunit...3059 days ago
Video
Translational Bioinformatics: Transforming 300 Billion Points of Data
...well described. The nascent field of translational bioinformatics may help. Dr. Butte's lab at Stanford University builds and applies tools that convert more than 300 billion points...3895 days ago
Bio-Scripts
BioPerl to convert between sequence formats from Fasta to Genbank
#!/usr/local/bin/perl -w # Sequence formats to choose: Fasta, EMBL. GenBank, Swissprot, PIR and GCG use Bio::SeqIO; $inFile = "BRCA2.fa"; $in = Bio::SeqIO-...2900 days ago
Convert newline formated sequence into fasta format with perl
use strict; use warnings; my $filename = $ARGV[0]; open(my $fh, '2354 days ago
- +24 more Bio-Scripts
Tags
Comments
Comment on "Tools for Sequence translation !"
Sequence translation is the process of converting a DNA or RNA sequence into its corresp...several genetic codes and can also perform reverse translation (i.e., convert a protein sequence into its c...405 days ago
Comment on "Run miniasm assembler on nanopore reads !"
...\ /home/data/20170911_oly_pacbio_cat.fastq /home/data/20170911_minimap2_pacbio_oly.paf > /home/data/20170918_oly_pacbio_miniasm_reads.gfa 3 Convert miniasm output GFA to FASTA...2151 days ago
- +3 more Comments
