Results for "Coordinates"
Tags
Extract the numeric values from the multiple FASTA sequence file.
I have a multiple fasta sequence file (~12GB size) with certain coordinate information:> chr13-/454-4567654 (2347645)AGTGACTGACTGAAGTGACTGA > chr14-/524-8367954 (6535786)AGTGACTGAAGTGACTGAThe fasta sequence string would always have only one or more continuous stretch of numbers, like ...Tags: Extract, Number, Fasta, Coordinates
3631 days ago
- CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file...
Tags: Bioinformatics, Analysis, NGS, CrossMap, Genome, Coordinates
2783 days ago
- LiftOver is a necesary step to bring all genetical analysis to the same reference build. LiftOver can have three use cases: (1) Convert genome position from one genome assembly to another genome assembly In most scenarios, we have known genome positions in NCBI build 36 (UCSC hg 18) and hope to...
Tags: LiftOver, Unlifted, lifted, switch, Coordinates, Genes, Genomes
2144 days ago
CrossMap: a program for convenient conversion of genome coordinates
CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file formats including SAM/BAM, Wiggle/BigWi...Tags: CrossMap, program, convenient, conversion, genome, coordinates
2150 days ago
CrossMap: program for genome coordinates conversion between different assemblies
CrossMap is a program for genome coordinates conversion between different assemblies (such as hg18 (NCBI36) <=> hg19 (GRCh37)). It supports commonly used file formats including BAM, CRAM, SAM, Wiggle, BigWig, BED, GFF, GTF,&nb...Tags: CrossMap, program, genome, coordinates, conversion, different, assemblies
815 days ago
