Results for "Education"

Tags

  • BINC Sample Question Paper !!!

    BINC sample question paper for round ONE.

    Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate

    3291 days ago

  • BINC Sample Question Paper !!!

    BINC sample question paper round TWO.

    Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate

    3291 days ago

  • BINC Sample Question Paper !!!

    BINC sample question paper round THREE ...

    Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate

    3291 days ago

  • BINC Sample Question Paper !!!

    BINC sample question paper. Wish you all the best for BINC examination.

    Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate

    3291 days ago

  • BINC examination 2015 !!!

    BioInformatics National Certification (BINC) Examination 2015 organized by Department of Biotechnology, Government of India, New Delhi Pondicherry University, Puducherry

    Tags: Bioinformatics, Computational Biology, Education, Study, Degree, BINC, Examination, 2015, India, Certificate

    3290 days ago

  • R 3.2.0 is released

    R 3.2.0 (codename “Full of Ingredients”) was released yesterday. You can get the latest binaries version from here. (or the .tar.gz source code from here). The full list of new features and bug fixes is provided below. Upgrading to R 3.2.0 on Windows If you ...

    Tags: Bioinformatics, Computational Biology, Education, Tutorial, R, Upgrade, R 3.2.0

    3289 days ago

  • Affy has acquired Eureka Genomics for 15M $

    Affymetrix Acquires Assets Of Eureka Genomics Corporation To Provide High Throughput And Economical Crop And Animal Genotyping http://www.thestreet.com/story/13151062/1/affymetrix-acquires-assets-of-eureka-genomics-corporation-to-provide-high-throughput-and-economical-crop-and-animal-genotyping....

    Tags: Bioinformatics, Computational Biology, Education, Affymetrix, Acquires, Eureka, Genomics, Corporation

    3257 days ago

  • Perl One liner basics !!

    Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...

    Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic

    3253 days ago

  • Frequent words problem solution by Perl

    Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    3236 days ago

  • Reverse Complement Problem Solved with Perl

    Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (    "C" => "G",   ...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary

    3236 days ago