BOL

Results for "Find"

Bio-Scripts

• • Aaryan Lokwani@aaryan

  

  Install Perl Locally !

  ...Module::Metadata Statistics::Lite Tie::Autotie Tie::IxHash Log::Log4perl FindBin::Real Getopt::Long Catalys...L::Simple Test::XPath IO::String Bio::Perl version # Set $PERL5LIB to find these libraries, and set $PAT...

  2135 days ago

• • Nishi Singh@nishi

  

  Concatenate two given sequences, and find the length of the new sequence and also print out the second codon of the sequence

  #!/usr/bin/perl use strict; use warnings; #assign strings to variables my $DNA = "GATTACACAT"; my $polyA = "AAAA"; #concatenate two strings my $modifiedDNA...

  2907 days ago

• • Nishi Singh@nishi

  

  For a given DNA sequence find its RNA transcript, find its reverse complement and check if the reverse complement contains a start codon

  ...my $RNA = $DNA; $RNA =~ s/T/U/g; print "RNA sequence is $RNA\n"; #find the reverse complement of $DN.../g; print "Reverse complement of $DNA is $rcDNA\n"; #did it work? #find the reverse complement of $DN...

  2907 days ago

• • Radha Agarkar@radhaagarkar

  

  Find and replace ambiguous characters in fasta file with Perl and Bioperl

  #!/usr/bin/perl -w my $usage="\nUsage: $0 [-h] [-m char] [fastaFileName1 ...]\n". " -h: help\n". " -m: missing character\n". "Print out the name of...

  2905 days ago

• • Jit@jit.aber

  

  Extract sequence from UCSC

  ....= $chr . ":" . $start . "," . $end; my $xml = get($URL_gene); my $xp = XML::XPath->new(xml=>$xml); my $nodeset = $xp->find('/DASDNA/SEQUENCE/DNA/text()'); # find all sequences # there should...

  2900 days ago

• • Jit@jit.aber

  

  Find the number of each 2 consecutive characters AA, AC,AG,AT,CC,CA... with Perl

  #!/usr/bin/perl -w use strict; my $subject = "AACGTACTGACGTACTGGTTGGTACGA"; my %results = (); while ($subject =~ m/[ACTG][ATGC]/g) { # matched text = $&...

  2899 days ago

• • Abhinav@abhinav

  

  String matching with Perl

  ...found in dna1 : $m \n”; # match pattern in dna2 $m2 = $dna2 =~ m/$pattern/g; print “Was the ATG pattern found in dna2 : $m2 \n”; # find the position of the pattern m...

  2899 days ago

• • Radha Agarkar@radhaagarkar

  

  Needleman-Wunsch Algorithm in Perl

  #!/usr/bin/perl # USAGE: perl nw.pl HEAGAWGHEE PAWHEAE BLOSUM50.txt -8 # See: "Biological sequence anaysis" Durbin et al. ed. CUP 1998, Pg. 19 # Needleman...

  2896 days ago

• • Jit@jit.aber

  

  Perl script to find the absolute "full" path of the file !

  #!/usr/bin/perl use Cwd; my $this_file_full_path = Cwd::abs_path(__FILE__); print "$this_file_full_path\n"; use Cwd qw/ realpath /; ## $0; this script my $path = realpath($0); print $path;

  2869 days ago

• • Archana Malhotra@archana

  

  Genetic Algorithms demonstration with word DNA in Perl

  ...opulation; # population size my @parent_population; my @new_population; my $total_parent_slots = 1; while ($total_parent_slots) { # find out how many parent slots are...

  2362 days ago

• « Previous
• 1
• 2
• 3
• 4
• 5
• Next »