Results for "Map"
Bio-Scripts
Calculate some statistics for a DNA alignment with Perl
...ormat => 'fasta', -file => 't/data/nei_gojobori_test.aln'); my $alnobj = $in->next_aln; my ($seq1id,$seq2id) = map { $_->display_id } $alnobj->e...2633 days ago
Check overlapping range with Perl
#!/usr/bin/perl use strict; use warnings; my @ranges = 0; push @ranges, $ranges[-1] + 1 + int rand 200 for 1..10000; my @tests = map int rand $ranges[-1], 0..1000000; matc...2611 days ago
Genetic Algorithms demonstration with word DNA in Perl
...y: select only survivors from the population, # then use map to have only the fitness come through my @weights = map { $_->{fitness} } grep { $_->...($_) > 1 && length($_) < $max_entry_length } map { uc } @dictionary; # bui...2356 days ago
Perl script to run SATSUMA in loop !
#!/usr/bin/perl -w use strict; use File::Temp qw(tempfile); # Usage perl 1by1.pl for SATSUMA analysis # User need to set the reference multifasta file name he...2124 days ago
Perl subroutine to read genome/reads fasta file !
...ub readSeqFromFasta{ my $file = $_[0]; my (%map,$id,$seq); open(IN,$file) o...>/){ if(defined $id && defined $seq){ $map{$id} = $seq; $seq="";.../; } else { $seq=$seq.$_; } } $map{$id} = $seq; close(IN); r...2117 days ago
Long reads mapper bash script !
.../bash #only for LONG READS mapping #USAGE: runMapper.sh minimap2 ref.fa reads.f.../anaconda3/bin/samtools graphMapLoc=/home/urbe/Tools/graphmap/...ovided" echo "#USAGE: runMapper.sh minimap2 ref.fa reads.f...fi elif [ $toolName == "minimap2" ]; then echo "Mapping w...2106 days ago
Perl script to create a consensus of nucleotide sequences !
...T=>[], C=>[], G=>[] ); s/\s//g for @mi; my ($w) = sort {$b $a} map {length} @mi; # set w to t.... my %h = ( a=>0, t=>0, c=>0, g=>0 ); my @mi_letters = map { [split '', uc $_] } @mi;...2016 days ago
- Map them agaist reference avaga genome using following codes git clone https://github.com/lh3/bwa.git cd bwa; make bwa index ref.fa bwa mem -x pacbio ref.fa pacbio.fq > aln.sam bwa mem -x ont2d ref.fa ont-2D.fq > aln.sam
1709 days ago
- ...e-combined-stream node-concat-map node-cookie-jar node-delayed-...nic/universe amd64 node-pseudomap all 1.0.2-1 [3,534 B] Get:21...unselected package node-pseudomap. Preparing to unpack .../19-...1) ... Setting up node-pseudomap (1.0.2-1) ... Setting up lib...
1537 days ago
- use v6; my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; sub MAIN($input = $default-input) { "{.map({ +$input.comb(/$_/) })}".say; } #I love perl v6
1543 days ago
