Results for "Perl"
Tags
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3240 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3240 days ago
Rosalind Problem Solution with Perl
Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3240 days ago
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3240 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2322 days ago
- You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks. The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequ...
Tags: Bioinformatics, Computational Biology, Education, Solution, Study, Script, Perl, Python, R, Code
3222 days ago
