Results for "Rosalind"


  • Rosalind Bioinformatics problems !!!

    Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works.

    Tags: Bioinformatics, Computational Biology, NGS, Genome, RNA-Seq, Algorithms, Online, Rosalind

    1010 days ago

  • Pattern Matching Problem Solution with Perl

    Problem at #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    836 days ago

  • Frequent words problem solution by Perl

    Solved with perl #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    836 days ago

  • Rosalind Problem Solution with Perl

    Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at I will...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    836 days ago

  • Clump Finding Problem Solved with Perl

    The question at #Find patterns forming clumps in a string.#Given: A string Genome, and integers k, L, and t.#Return: All distinct k-mers forming (L, t)-clumps in Genome.use strict;use warnings;my %myHash;my $string="CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAG...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind

    836 days ago

  • Bioinformatics Contest 2017!

    Bioinformatics Contest 2017! Rosalind is co-organizer. Compete with thousands of people worldwide on bioinformatics problem solving. Everything is online. Qualification round starts on January 23, 2017. Final is on Feb 18. You will need to solve bioinformatics problems using programming. The goa...

    Tags: Bioinformatics, Contest2017, 2017, Rosalind, Online

    274 days ago