BOL

Results for "Script"

Tags

• • Jit@jit.aber

  

  Bioinformatics Scripts

  Some of the useful bioinformatics scripts. For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly. http://milkweedgenome.org/?q=scripts

  Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Python

  3346 days ago

• • Jitendra Narayan@admin

  

  Creates 100 random DNA sequences with 20 residues. sapply(1:100, function(x) paste(sample(c("A","T","G","C"), 20, replace=T), collapse="")) #R #Random #Sequence #DNA #Script

  Tags: R, Random, Sequence, DNA, Script

  3610 days ago

• • Ram Yash Pal@ramyash

  

  Introduction to programming. Write short programs that generate graphics and animation.

  Introduction to programming. Write short programs that generate graphics and animation. http://funprogramming.org/

  Tags: Fun, Program, Animation, Script

  3536 days ago

• • Tenzin Paul@tenzin

  

  Making Your Code Citable http://computationalproteomic.blogspot.in/2014/08/making-your-code-citable.html #Code #Repository #Citable #Script

  Tags: Code, Repository, Citable, Script

  3450 days ago

• • Jitendra Narayan@admin

  

  Coding Ground

  Online coding group for most of the programming languages. Code in almost all popular languages using Coding Ground. Edit, compile, execute and share your projects, 100% cloud. http://www.tutorialspoint.com/codingground.htm

  Tags: Bioinformatics, Languages, Coding, Programming, Learn, Code, Script

  3322 days ago

• • Abhimanyu Singh@abhimanyu

  

  Perl One liner basics !!

  Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:$ perl -e 'pr...

  Tags: Bioinformatics, Computational Biology, Education, Study, Script, Perl, Oneliner, Basic

  3254 days ago

• • Jit@jit.aber

  

  Reverse Complement Problem Solved with Perl

  Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (    "C" => "G",   ...

  Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary

  3237 days ago

• • Jit@jit.aber

  

  Pattern Matching Problem Solution with Perl

  Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...

  Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

  3237 days ago

• • Jit@jit.aber

  

  Rosalind Problem Solution with Perl

  Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...

  Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

  3237 days ago

• • Jit@jit.aber

  

  Frequent words problem solution by Perl

  Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

  Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

  3237 days ago

• « Previous
• 1
• 2
• 3
• 4
• 5
• Next »