Results for "Solution"
Users
About me: ...benchmark-ability, and data analysis capability of genomics data over other forms of biological data. ArrayGen constantly strives to develop new solutions, and plug the existing gaps...2692 days ago
- About me: I am a graduate in B.Tech Information Technology and i am completly intrested in bio informatics . Eager to design a solution in the fiels of bio informatics
3384 days ago
- +1 more Users
Blogs
How to install Perl modules manually, using CPAN command, and other quick ways
...ies is tedious and annoying process. Some of the packages like GD is the real pain. However, Installing Perl modules using CPAN is a better solution, as it resolves all the depen...3934 days ago
Five unique traits of effective computational biologist
...te a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause..., learn enough about the underlying system to look for other clues and solutions, and learn to take a long di...3934 days ago
- +2 more Blogs
Bookmarks
- ...echniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under...
1087 days ago
- ...es a tool to fix misassemblies by using paired-end reads to achieve an accuracy comparable to other assemblers, this is not a favorable solution.Fermi is designed to be used...
2779 days ago
- +9 more Bookmarks
Files
Bioinformatics approach to Boar Taint
...sm of androstenone and sex steroids share a common pathway which makes removal of boar taint a very challenging task. Castration is a traditional solution to remove boar taint but it a...3773 days ago
Discussion topics
- Like in case of plant genomes where nature of genome is too complex and huge in size to accomplish complete de novo assembly by current sequencing technology. What would be alternate solution? Can we live in reference free world?
3928 days ago
- The key to finding a solution is to notice that most genomicsequences differ by very little. It may well be that the number of complete genome sequences being stored is incre...
3903 days ago
Pages
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-...3236 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome...3236 days ago
- +3 more Pages
Top-level pages
- ...ocess whereas non-deterministic algorithm must perform guesses of best solution at each step through the use...nd conquer algorithm, that solves an identical subproblem and uses the solution of this subproblem to solve t...
3930 days ago
Bioinformatics Companies in India
...w any specific pattern. 1. Accelrys Software Solution Pvt Ltd.12th Floor, Discover,...sh; 110 092www.labnetworx.com 18. LabVantage Solutions Pvt. Ltd.Bengal Intelligent...ics.comwww.novoinformatics.com 23. Ocimum Biosolutions (India) Ltd6th Floor, Relian...3909 days ago
- +4 more Top-level pages
News
- ...onference, data analysis specialist eoda starts the public alpha testing of translate2R. With the start of alpha testing the innovative migration solution by the company hailing from K...
3437 days ago
Roche has acquired Bina Technologies !!!
...continue to focus on development of their innovative genomic analysis solution.Roche has acquired Bina Techn...tics and data sciences are critical elements of an end-to-end genomics solution. Fast, easy-to-use, scalable,...3397 days ago
- +2 more News
Opportunity posts
Research Assistant @ NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES
...post of Research Associate under DBT sponsored Support under BIPP for the “SanGenix: A comprehensive Next Generation Sequence (NGS) data analysis solution” as Grants in AID. Thepost du...3790 days ago
Senior Bioinformatician (Assembly) Moore Aquatic Symbiosis Project Tree of Life
...ong publication record and culture of producing open data resources and open source software development. This role requires an investigative and solution-oriented mindset and excellen...930 days ago
ResearchLabs posts
ArrayGen Bioinformatics Genomics Group
ArrayGen is a global bioinformatics company which is a one stop solution for microarray designing and genomic...r forms of biological data. ArrayGen constantly strives to develop new solutions, and plug the existing gaps...3490 days ago
Bio-Scripts
Bash script to split multifasta file !
...ze/10)+1 } /^>/ {if(n%chunksize==0){file=sprintf("chunk%d.fa",n);} print >> file; n++; next;} { print >> file; }' < multi.fasta #Another great solution is genome tools (gt), which y...807 days ago
Tryst
Tryst with a Bioinformatician # Dr Altan Kara
...produced biological data to derivate unified solutions for specific biological prob...o be enlightened and it's impossible to bring solutions to this diversity by using s...totally new methods that offer an alternative solution to various biological problem...2346 days ago
Tags
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3236 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3236 days ago
- +7 more Tags
Comments
Comment on "Retrieving Taxonomic Information with R"
Perl solution to the problem https://metacpan.org/pod/Bio::Taxon1694 days ago
- ...are presented in HTML permanent reports. FastQC can be run as a stand-alone application or it can be integrated into a larger pipeline solution. fastqp fastqp. Simple...
2121 days ago
- +2 more Comments
