Results for "Solution"
Tags
Frequent words problem solution by Perl
Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3242 days ago
Reverse Complement Problem Solved with Perl
Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = ( "C" => "G", ...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary
3242 days ago
Pattern Matching Problem Solution with Perl
Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3242 days ago
Rosalind Problem Solution with Perl
Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind
3242 days ago
Clump Finding Problem Solved with Perl
The question at http://rosalind.info/problems/1d/ Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perlTags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind
2324 days ago
- You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks. The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequ...
Tags: Bioinformatics, Computational Biology, Education, Solution, Study, Script, Perl, Python, R, Code
3224 days ago
Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud
InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines. With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and insta...Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Cloud, Server, Work, InsideDNA
3171 days ago
Rainbow: an integrated tool for efficient clustering and assembling RAD-seq reads
Rainbow is developed to provide an ultra-fast and memory-efficient solution to clustering and assembling short reads produced by RAD-seq. First, Rainbow clusters reads using a spaced seed method. Then, Rainbow implements a heterozygote calling like strategy to divide potential groups into haploty...Tags: Rainbow, ultra-fast, memory-efficient, solution, clustering, assembling, short, reads, RAD-seq
2015 days ago
- MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accele...
Tags: MEGAHIT, ultra-fast, single-node, solution, large, complex, metagenomics, assembly, succinct, de Bruijn, graph
1989 days ago
