Results for "Solution"

Tags

  • Frequent words problem solution by Perl

    Solved with perl http://rosalind.info/problems/1a/ #Find the most frequent k-mers in a string.#Given: A DNA string Text and an integer k.#Return: All most frequent k-mers in Text (in any order).use strict;use warnings;my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";my $kmer=4; my %myHash;my $max=0...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    867 days ago

  • Reverse Complement Problem Solved with Perl

    Question at http://rosalind.info/problems/1b/ #Find the reverse complement of a DNA string.#Given: A DNA string Pattern.#Return: Pattern, the reverse complement of Pattern.use strict;use warnings;my $string="AAAACCCGGT";my $finalString="";my %hash = (    "C" => "G",   ...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Reserve, Complementary

    867 days ago

  • Clump Finding Problem Solved with Perl

    The question at http://rosalind.info/problems/1d/ #Find patterns forming clumps in a string.#Given: A string Genome, and integers k, L, and t.#Return: All distinct k-mers forming (L, t)-clumps in Genome.use strict;use warnings;my %myHash;my $string="CGGACTCGACAGATGTGAAGAAATGTGAAGACTGAGTGAAGAGAAG...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Clump, Rosalind

    867 days ago

  • Pattern Matching Problem Solution with Perl

    Problem at http://rosalind.info/problems/1c/ #Find all occurrences of a pattern in a string.#Given: Strings Pattern and Genome.#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.use strict;use warnings;my $string="GATATATGCATATACTT";my $subStr="A...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    867 days ago

  • Rosalind Problem Solution with Perl

    Rosalind is a platform for learning bioinformatics and programming through problem solving. Take a tour to get the hang of how Rosalind works. Bioinformatics Textbook Track Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track I will...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Perl, Frequest, Words, Rosalind

    867 days ago

  • BioScripts

    You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks. The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequ...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Study, Script, Perl, Python, R, Code

    849 days ago

  • Bioinformatics Made Easy Search: Bioinformatics tools and run genomic analysis in the cloud

    InsideDNA makes hundreds of bioinformatics tools immediately available to run via an easy-to-use web interface and allows an accurate search across all functions, tools and pipelines. With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and insta...

    Tags: Bioinformatics, Computational Biology, Education, Solution, Puzzle, Study, Script, Cloud, Server, Work, InsideDNA

    796 days ago