Alignment-free sequence comparison tools available for next-generation sequencing data analysis
...asures (e.g., d2) Software (C++) https://github.com/jessieren/VirHostMatcher MetaFast Statistics calculation of metagenome sequences and the distances between them based on assembl...2356 days ago
Edit distance application in bioinformatics !
...Levenshtein qw(distance); print distance("foo","four"); # prints "2" my @words = qw/ four foo bar /; my @distances = distance("foo",@words); print "@distances"; # prints "2 0 3" use Alg...2326 days ago
LINKS scaffolder bloomfilter setting !
...ATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC -d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional) Multiple distances are separated by comma. eg. -...2136 days ago