Results for "fields"
Bio-Scripts
Fill up the form and blast with perl
...quence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'bla...2313 days ago
Create genome scaffolding with Perl
...-separated values, got %d)", scalar(@fields)), -verbose =...e) ? 1 : 0; my $longTarget = (1 - $shortTarget); my $sName = $fields[9 + ($shortTarget * 4)];...2296 days ago
- ...ate a non-M2 VCF (using the associated tumor bam) with pair orientation fields (e.g. F1R2 ). AnnotateVc...Validate VCF VariantsToTable Extract fields from a VCF file to a tab-deli...
2063 days ago
- ...of text into individual words or pieces called fields. #NR: NR command keeps a...#NF: NF command keeps a count of the number of fields within the current input reco...he output field separator, which separates the fields when Awk prints them. The def...
882 days ago
- ...with open(gff_file, 'r') as gff: for line in gff: if not line.startswith('#'): fields = line.strip().split('\t') if fields[2] == 'gene':...
82 days ago
Perl and BioPerl script to extract protein sequences using GFF file !
#!/usr/bin/perl use strict; use warnings; use Bio::DB::Fasta; use Bio::SeqIO; # Paths to your GFF file and genome FASTA file my $gff_file = 'path/to/your/file.g...82 days ago
Perl script to parse VCF file !
#!/usr/bin/perl use strict; use warnings; # Usage: ./parse_vcf.pl input.vcf die "Usage: ./parse_vcf.pl input.vcf\n" unless @ARGV; my $vcf_file = shift @ARG...82 days ago
Perl script to parse blast results and plot basic stats !
#!/usr/bin/perl use strict; use warnings; use List::Util qw(sum); # Usage: ./parse_blast.pl blast_result.txt die "Usage: ./parse_blast.pl blast_result.txt\n"...82 days ago
Python script to parse GFF file
...'#'): # Ignore comment lines fields = line.strip().split('\t')...feature = { 'seqid': fields[0], 'sou...int(fields[4]), 'score': fields[5], 'str...26 days ago
