Results for "fields"
Users
About me: Always wanna to work with different fields of science and willing to learn every new technique as well tools. Am currently a Ph.D scholar in bioinformatics . Working in network. From...2247 days ago
Blogs
Bioinformatics PhDs - Cover Letter
...he courses that (based on the job description) you would be expected to offer, let them know. If you have not had that opportunity, but your fields and research fall within the...3350 days ago
Computer simulation of genetic mechanism !!
...lds. Within the overall task of simulation, there are three primary sub-fields: model design, model executio...xperimental results; and (3) they enable connecting biology with other fields of study ranging from physiol...2959 days ago
- +8 more Blogs
Bookmarks
Following the scientific literature: A personal practical guide for young computational biologists
... can you follow the most up-to-date science of interest and what papers/journals you should follow. The guide is biased towards the fields of genomics/systems biology.(...3892 days ago
International Conference on Bioinformatics Models, Methods and Algorithms
...ta management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields. Position Paper Submission E...3484 days ago
- +6 more Bookmarks
Files
Basic Notions in Molecular Biology and Genetics
...as stablished on 2007, took it a bit of years to make it real this initative, although, nowadays, we're working on some projects involved in those fields. This research group belongs...3686 days ago
Top-level pages
- ...fective method for solving a problem using a finite sequence of instructions. Algorithms are used for calculation, data processing, and many other fields.Each algorithm is a list of w...
3930 days ago
Best book Titles for Learning Bionformatics
...s to Bioinformatics (Introduction to Biotechniques Series), Luke Alphey, 1997, Springer Verlag Automated DNA sequencing and analysis, Adams M.D., Fields C., Venter J.C. (Editors), 19...3901 days ago
- +8 more Top-level pages
Wire posts
News
- ...ectronic Chemical Potential.[Dr. D. K. Maity, BARC, Mumbai]8. Molecular MechanicsIntroduction; Empirical Force Fields; Force Field Parameterization; Differences in Force Fields; Energy Minimization; Limitat...
3813 days ago
NCBI to assist in Virus Hunting Data Science Hackathon
...bsp;San Diego State University! NCBI Hackathon specifically looking for folks who have experience in computational virus hunting or adjacent fields to identify known, taxonomica...1982 days ago
- +1 more News
Opportunity posts
"Advances in Molecular Dynamics of Biomolecules" December 3-4, 2013 @ JNU
...lgorithms combine domain knowledge from various disciplines of basic science and computer programming, training manpower in such interdisciplinary fields may be hardly achieved within...3861 days ago
National Training on Bioinformatics Computational Tools for Microbial Research Nov 19 to 30, 2013
Agricultural research in modern scientific arena is being represented by proper integration among various research fields of biological, chemical and physical sciences, because this f...3857 days ago
- +26 more Opportunity posts
ResearchLabs posts
- GABi Research The major researching fields defined as the GABi scope are described next: Sequence Analysis Protein Structure Prediction Comparative Genomics Funct...
3787 days ago
- ...s endeavor has a number of related aspects described below. Moreover, the approaches we take have broad connections to a variety of data-intensive fields, within the emerging discipli...
3684 days ago
- +1 more ResearchLabs posts
Video
Computer Theory & Genetics: George Chao at TEDxUMNSalon
...mputational techniques to learn from genetic data. He would like to go into a career of research into the application of bioinformatics in various fields. ---- The individuals invol...3899 days ago
Showreel 2008 - Cortical Studios
...tics company that combines 3D animation, multimedia and scientific knowledge to meet your communication needs. With our academic background in the fields of biotechnology and molecula...3842 days ago
Bio-Scripts
Fill up the form and blast with perl
...quence = 'GCCCGCGGTCTCAGAGATCTCGATATATTATA'; $mech->get('http://www.arabidopsis.org/Blast/'); $mech->submit_form( form_name => 'myForm', fields => { 'Algorithm' => 'bla...2309 days ago
Create genome scaffolding with Perl
...-separated values, got %d)", scalar(@fields)), -verbose =...e) ? 1 : 0; my $longTarget = (1 - $shortTarget); my $sName = $fields[9 + ($shortTarget * 4)];...2292 days ago
- +7 more Bio-Scripts
Comments
Comment on "Sibelia: A comparative genomics tool"
...block id>,Start=<x>,End=<y> Where "<header>" is a header of the FASTA sequence where the block instance is located. Other fields are described in section "Coo...1269 days ago
Comment on "Various scholarships around the world !!"
...promote basic sciences in Korea. Twenty-eight Research Centers have been launched and each Center has been yielding outstanding results in various fields of research.The IBS "You...2103 days ago
- +3 more Comments
