Commercial and public next-gen-seq (NGS) software
...find semiglobal non-gapped alignments based on k-mer seeds. http://bibiserv.techfa...find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmus...netics. SSAKE - The Short Sequence Assembly by K-mer search and 3' read Extension...3508 days ago
Software packages for next gen sequence analysis
...; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmus...titute for Molecular Genetics. * SSAKE - The Short Sequence Assembly by K-mer search and 3' read Extension...3231 days ago
Genome Assembly Tools and Software - PART1 !!
.... It based on the idea of frequent k-mer assembly. REPdenovo provides...ies.1.Assembly. This step performs k-mer counting. Then we find freque...54). KmerGenie 1.6982 – K-mer size Selection for Genome Ass...owards Optimal Guided Selection of k-mer Size for Sequence Assembly....2674 days ago
Alignment-free sequence comparison tools available for next-generation sequencing data analysis
...using RNA-seq data (uses k-mers) https://combine-lab.github...pt prediction using gene k-mers profiles of the RNA-seq pair...dquo;, a special type of k-mers) Software (C) https://gith...rtainty in the tree topology (k-mer based) Software (Python) ht...2360 days ago
2340 days ago
Computational resources for TE discovery and TE detection
Transposable Elements (TEs) to genome structure and evolution as well as their impact on genome sequencing, assembly, annotation and alignment has generated increasing...2263 days ago
LINKS scaffolder bloomfilter setting !
...CGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC -d distance between k-mer pairs (ie. target distances t...ltiple distances are separated by comma. eg. -d 500,1000,2000,3000 -k k-mer value (default -k 15, optiona...2140 days ago