BOL: All site questions

Apps for Bioinformatics

RaghavaGPS — Wed, 11 Jun 2014 01:27:56 -0500

We are traditional web developer for bioinformatics related problem. Nowadays mobile apps are becoming very popular. My question is should we also develop Apps in addition to web services for biology related problem. According to you what is scope of "Apps based Bioinformatics". We need your frank opinion from user as well as developers point of view.

Is Linux OS necessary for Bioinformatics? If yes which one is the best for NGS analysis.

Radha Agarkar — Tue, 03 Jun 2014 21:18:01 -0500

I am currently working on NGS, and looking for a nice OS to handle huge amount of genomics data with an ease. Someone suggested me that Window OS will be a bad idea to use for NGS analysis. I need your valuable suggestion for the best.

Thanks

Please recommend some books / study material on DNA diagnostics using bioinformatics.

Andaleeb — Mon, 19 May 2014 07:27:20 -0500

Extract the numeric values from the multiple FASTA sequence file.

Alok Prajapati — Sun, 11 May 2014 14:38:16 -0500

I have a multiple fasta sequence file (~12GB size) with certain coordinate information:

> chr13-/454-4567654 (2347645)
AGTGACTGACTGAAGTGACTGA

> chr14-/524-8367954 (6535786)
AGTGACTGAAGTGACTGA

The fasta sequence string would always have only one or more continuous stretch of numbers, like 13-/454-4567654 (2347645) in this case. Rest all will be either alphabets or other special characters. How can I extract the number and store it back in some array?

Annotating a sequence not yet published

ruchira — Wed, 07 May 2014 15:26:24 -0500

I have 198,991 bp long sequence. I ran it through Maker, Glimmer and GeneMarkS. All three gave me different number of predicted genes.Here I am talking about genes that I got through GeneMarkS.

Now when I am using BlastX to find the similar genes, I sometimes get highly dissimilar results. What does that indicate?

For eg:- for the given gene

>gene_id_13
ATGTTCGCGGGCGTAGTGCGCAGTTTCGTGCAGTGGAGACGAGTCGATGACACCGCCGTC
AGAGACGGTGAATGGCAAGACGAACGCGGCCGGATTGACTGGTTCGAATGA

After running blastX for gene 13, I get results with evalue 4.3 and above and sequences that are only 43% similar.

stage II sporulation protein D [Bacillus amyloliquefaciens]

33.1

81%

4.3

43%

WP_017418739.1

>gene_id_14
ATGCTCGGACTGATGAAGGCCTGCAAAAAGCTCGGCCTGTCGTTCTGGCAGTATCTCTGT
GATCGCATCGGTGTCGATGGCCAGGCCATTCCGCCGCTGGCCGCCCTTGTCGGGGCAAAA
GCCTAA

with this gene, i got the following result

putative protein y4jO [Rhizobium sp. LPU83]

76.6

97%

5e-16

80%

CDM61676.1

Now if I combine genes 13 and 14. I got

putative protein y4jO [Rhizobium sp. LPU83]

78.2

92%

4e-16

57%

CDM61676.1

what does that suggest?

Also, how to find the correct number of predicted genes when all three tools give different results?

Thanks

How do computer visualize chemical structure?

Bhavana Rahangdale — Sun, 20 Apr 2014 05:48:19 -0500

Can someone please explain how computer identify rings and chains (and complete structure) from a Coordinate file(PDB or Mol2)? As various softwares are available to visualize the structure but i want to know how these software do it, how they identify where a chain start and how ring(or cyclic) structure(like benzene etc) is identified?

Have you use software developed at our lab

RaghavaGPS — Wed, 16 Apr 2014 00:11:34 -0500

I am just interested to know whether you are aware about web servers developed at our group or not. http://www.imtech.res.in/raghava/

May I know your view on Bioinformatics scope

RaghavaGPS — Wed, 16 Apr 2014 00:08:04 -0500

There are contradictory statement about job scope of bioinformatics. One side we got statement that BI have lot of job prospetives other side lot of student complains that they are not getting jobs. I am interested to know form real bioinformatics persons, did you get job of your choics, if not what major difficulties you are facing. According to you what is trend in bioinformatics from job point of view. What you will advise to youngsters? they should go for bioinformatics or not.

What are the common job requirements for Bioinformatician and Computational Biologist?

Aaryan Lokwani — Tue, 15 Apr 2014 14:17:38 -0500

I want to know the common job requirement for bioinformatics post in current scenario ...

Can you please tell me the an online software/tools to detect/predict/find the promoter region ?

Prachi Taneja — Thu, 27 Mar 2014 13:14:18 -0500

Hello everyone, Can you please tell me an online software/tools to detect/predict/find the promoter region in rice plant. Many thanks for your time.