BOL: All site questions

What is the difference between data mining and text mining?

Any — Fri, 03 Mar 2017 16:57:57 -0600

In school the teachers refer to both terms as one, but according to what I have read they are not the same and don't use the same methologies so I am a bit confused.

How to print only the first best hit from blastn tool?

Marysia — Thu, 02 Mar 2017 09:08:17 -0600

I used the following command to print the blast hit.

[Terminal] blastn -query aaa.fa -db blastdb/nt -evalue 10e-5 -num_threads 4 -max_target_seqs 1 -outfmt '6 qseqid staxid qstart qend sallseqi sstart send evalue length frames qcovs' -out testBlastSee

But the outfile print many hits, I only want the top one.

[Terminal] more testBlastSee                                                                                                                  []
Lactococcus_lactis   1   63350   1   63350   0.0   63350   1/1   100
Lactococcus_lactis   52453   55105   138601   141250   0.0   2654   1/1   100
Lactococcus_lactis   52393   53898   629230   627727   0.0   1508   1/1   100
Lactococcus_lactis   52411   53898   2217595   2216111   0.0   1489   1/1   100
Lactococcus_lactis   52413   53898   2157259   2155777   0.0   1487   1/1   100
Lactococcus_lactis   52452   53898   838503   837059   0.0   1449   1/1   100
Lactococcus_lactis   52453   53860   374322   375726   0.0   1409   1/1   100
Lactococcus_lactis   53859   55105   2154570   2155816   0.0   1247   1/1   100
Lactococcus_lactis   53860   55105   626521   627766   0.0   1246   1/1   100
Lactococcus_lactis   53858   55105   835851   837098   0.0   1248   1/1   100
Lactococcus_lactis   53860   55105   2214905   2216150   0.0   1246   1/1   100
Lactococcus_lactis   53860   55104   374321   373077   0.0   1245   1/1   100
Lactococcus_lactis   53860   55104   138600   137356   0.0   1245   1/1   100
Lactococcus_lactis   53860   55104   839748   838504   0.0   1245   1/1   100
Lactococcus_lactis   40213   41128   508317   507400   0.0   922   1/1   100
Lactococcus_lactis   28448   28695   543445   543703   9e-96   260   1/1   100
Lactococcus_lactis   42193   42376   506963   506780   4e-64   184   1/1   100
Lactococcus_lactis   61964   62163   61646   61845   6e-53   200   1/1   100
Lactococcus_lactis   61646   61845   61964   62163   6e-53   200   1/1   100
Lactococcus_lactis   37541   37672   512963   512832   3e-50   132   1/1   100
Lactococcus_lactis   28816   28933   2360018   2359903   7e-32   118   1/1   100
Lactococcus_lactis   35284   35410   1439702   1439828   1e-30   129   1/1   100
Lactococcus_lactis   28272   28363   1412439   1412348   1e-29   92   1/1   100
Lactococcus_lactis   28193   28270   2360127   2360050   2e-28   78   1/1   100
Lactococcus_lactis   28695   28813   542396   542514   6e-23   122   1/1   100
Lactococcus_lactis   28695   28813   1981268   1981150   6e-23   122   1/1   100
Lactococcus_lactis   28695   28813   2341071   2340953   6e-23   122   1/1   100
Lactococcus_lactis   28695   28812   2360250   2360133   2e-22   121   1/1   100
Lactococcus_lactis   28695   28796   2218330   2218229   8e-22   103   1/1   100
Lactococcus_lactis   28695   28796   2260841   2260740   8e-22   103   1/1   100
Lactococcus_lactis   55066   55147   2154609   2154528   2e-17   82   1/1   100
Lactococcus_lactis   55066   55148   626559   626478   5e-14   83   1/1   100
Lactococcus_lactis   52392   52456   373013   373076   2e-12   65   1/1   100
Lactococcus_lactis   55105   55148   375723   375766   1e-09   44   1/1   100
Lactococcus_lactis   52393   52457   839809   839745   1e-09   66   1/1   100

How to resolve following error in Perl ?

Anjana — Wed, 22 Feb 2017 04:30:24 -0600

When I tried Perl on my cluster/server it gives following error !! How to resolve it?

$ perl
perl: warning: Setting locale failed.
perl: warning: Please check that your locale settings:
LANGUAGE = (unset),
LC_ALL = (unset),
LC_PAPER = "de_BE.UTF-8",
LC_ADDRESS = "de_BE.UTF-8",
LC_MONETARY = "de_BE.UTF-8",
LC_NUMERIC = "de_BE.UTF-8",
LC_TELEPHONE = "de_BE.UTF-8",
LC_IDENTIFICATION = "de_BE.UTF-8",
LC_MEASUREMENT = "de_BE.UTF-8",
LC_TIME = "de_BE.UTF-8",
LC_NAME = "de_BE.UTF-8",
LANG = "en_US.UTF-8"
are supported and installed on your system.
perl: warning: Falling back to a fallback locale ("en_US.UTF-8").

How to install Perl packages on servers?

Shruti Paniwala — Mon, 20 Feb 2017 04:54:12 -0600

I am problem installing Perl module on cluster/server without root. Can you please recommend me a easy way or alternative way to install it.

Can you recommend me some interactive tools to visualize chromosomes?

Shruti Paniwala — Fri, 17 Feb 2017 08:59:11 -0600

I am looking for new, interactive and user friendly tools to see chromosomal rearrangements. I tried IGV, but it does not seems to be very helpful for chromosomal rearrangements visualization. Circos look pretty useless, as it does not allow me to explore well. Help Please...

How to extract sequence from a multifasta file?

Neel — Thu, 16 Feb 2017 04:26:42 -0600

Extract "Seq2" from the list below
>Seq1
GTGCACTAAGAAAAATAAAATTTGTTCTTTTAAGATAATCATTTC
CTGGACGAATATCAATAGCAATAGAATAAGTCCAATCAAATGAT
TGCCGTGATGAACGAACTTGTAATTGTTGATAACTAGAACCAT
GCTGTAAACAAAATTTTGATGACCATTGTGGTCGACCTTCTTGT
TGACGATGTAAACCATTTCCAACTCGCATAACACATGTATTATTA
CGCTGAGCATTATCGAAAGAAAGAAGAAGT
>Seq2
CAGGGCCAGCGCCGCCGACAGGCCGGTGAAGCCGCCGCCGA
CGATGGCCACGTCCACCTGCGCCGGCAGGTCTTGCGACCGCG
GCACGAAGGCGGGGGCGGAATCGGTCCAGTACGGGTCGAGCT
TCATGGCGGCGGCGAGGGGCGGGAAGGGCAGCGTTCGATCAG
GGGCCGGGGTTCAGAGACCCACCACGCCGGGCAGGCCGCCGA
TGTCCTGGATCTCGACATAGCGATAGGCCGGGTTGCCCGGGC

How to publish research paper on miRNA dataset?

mahree khan — Thu, 09 Feb 2017 10:45:45 -0600

I want to publish my research work on miRNA. I used online "freely" available miRNA dataset, with not known publications, and analysed it. Can you please suggest your experience publishing it in a good Impact Factor Journal? Is this possible to published it?

How to fix following MizBee error

Abhimanyu Singh — Thu, 02 Feb 2017 04:37:02 -0600

I got the following error while running MizBee.How to fiw it.

./MizBee                                    []
OpenJDK 64-Bit Server VM warning: You have loaded library /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so which might have disabled stack guard. The VM will try to fix the stack guard now.
It's highly recommended that you fix the library with 'execstack -c ', or link it with '-z noexecstack'.
Exception in thread "Animation Thread" java.lang.UnsatisfiedLinkError: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: /home/abhi/Downloads/application.linux(1)/application.linux/libgluegen-rt.so: wrong ELF class: ELFCLASS32 (Possible cause: architecture word width mismatch)
   at java.lang.ClassLoader$NativeLibrary.load(Native Method)
   at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1941)
   at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1857)
   at java.lang.Runtime.loadLibrary0(Runtime.java:870)
   at java.lang.System.loadLibrary(System.java:1122)
   at com.sun.gluegen.runtime.NativeLibLoader.loadLibraryInternal(NativeLibLoader.java:102)
   at com.sun.gluegen.runtime.NativeLibLoader.access$000(NativeLibLoader.java:51)
   at com.sun.gluegen.runtime.NativeLibLoader$1.run(NativeLibLoader.java:70)
   at java.security.AccessController.doPrivileged(Native Method)
   at com.sun.gluegen.runtime.NativeLibLoader.loadGlueGenRT(NativeLibLoader.java:68)
   at com.sun.gluegen.runtime.NativeLibrary.ensureNativeLibLoaded(NativeLibrary.java:399)
   at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:163)
   at com.sun.gluegen.runtime.NativeLibrary.open(NativeLibrary.java:129)
   at com.sun.opengl.impl.x11.DRIHack.begin(DRIHack.java:109)
   at com.sun.opengl.impl.x11.X11GLDrawableFactory.(X11GLDrawableFactory.java:99)
   at java.lang.Class.forName0(Native Method)
   at java.lang.Class.forName(Class.java:264)
   at javax.media.opengl.GLDrawableFactory.getFactory(GLDrawableFactory.java:111)
   at processing.opengl.PGraphicsOpenGL.allocate(PGraphicsOpenGL.java:173)
   at processing.core.PGraphics3D.setSize(PGraphics3D.java:323)
   at processing.core.PApplet.makeGraphics(PApplet.java:1321)
   at processing.core.PApplet.size(PApplet.java:1142)
   at processing.core.PApplet.size(PApplet.java:1102)
   at MizBee.setup(MizBee.java:87)
   at processing.core.PApplet.handleDraw(PApplet.java:1571)
   at processing.core.PApplet.run(PApplet.java:1496)
   at java.lang.Thread.run(Thread.java:745)

How to resolve this "built-in MySQL server cannot run" error in SyMAP ?

Poonam Mahapatra — Wed, 01 Feb 2017 05:01:23 -0600

I tried SyMAP but got the following error

$ ./symap []
Starting SyMAP v4.2 - Project Manager
SyMAP Version v4.2
Java Version 1.8.0_91, mem: 1820M
Build 116
Reading from file symap.config
The built-in MySQL server cannot run because a MySQL server is already running on this computer.
Please stop that server, or else specify a MySQL host name in the symap.config file.

How to predict miRNA targets?

pradyumna Jayaram — Tue, 03 Jan 2017 04:06:33 -0600

If i have a set of miRNA sequences, what are the tools that are available to predict the target genes? I tried miRanda and mirdb, are there any tools or databases that do the same, as the rna is not already known i cant use targetscan etc. The tool must predict the target from the fasta sequence of miRNA.

Thank you