<![CDATA[BOL: Extract the numeric values from the multiple FASTA sequence file.]]> https://bioinformaticsonline.com/answers/view/10761/extract-the-numeric-values-from-the-multiple-fasta-sequence-file? https://bioinformaticsonline.com/answers/view/10761/extract-the-numeric-values-from-the-multiple-fasta-sequence-file Sun, 11 May 2014 14:38:16 -0500 https://bioinformaticsonline.com/answers/view/10761/extract-the-numeric-values-from-the-multiple-fasta-sequence-file <![CDATA[Extract the numeric values from the multiple FASTA sequence file.]]> I have a multiple fasta sequence file (~12GB size) with certain coordinate information:

> chr13-/454-4567654 (2347645)
AGTGACTGACTGAAGTGACTGA

> chr14-/524-8367954 (6535786)
AGTGACTGAAGTGACTGA

The fasta sequence string would always have only one or more continuous stretch of numbers, like 13-/454-4567654 (2347645) in this case. Rest all will be either alphabets or other special characters. How can I extract the number and store it back in some array?

]]> Alok Prajapati