BOL: All site bookmarks

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

VG: variation graph data structures, interchange formats, alignment, genotyping, and variant calling methods

Jit — Tue, 28 Jan 2020 03:53:24 -0600

Variation graphs provide a succinct encoding of the sequences of many genomes. A variation graph (in particular as implemented in vg) is composed of:

nodes, which are labeled by sequences and ids
edges, which connect two nodes via either of their respective ends
paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

vt: a variant tool set that discovers short variants from Next Generation Sequencing data.

Jit — Tue, 28 Jan 2020 03:44:43 -0600

vt is a variant tool set that discovers short variants from Next Generation Sequencing data.

https://genome.sph.umich.edu/wiki/Vt

https://github.com/atks/vt

Address of the bookmark: https://genome.sph.umich.edu/wiki/Vt

MALVA: Genotyping by Mapping-free ALlele Detection of Known VAriants

Jit — Tue, 28 Jan 2020 03:39:22 -0600

MALVA is able to genotype multi-allelic SNPs and indels without mapping reads

MALVA calls correctly more indels than the most widely adopted genotyping pipelines

Mapping-free approaches are as accurate as alignment-based ones, while being faster

More at https://www.sciencedirect.com/science/article/pii/S2589004219302366

https://www.sciencedirect.com/science/article/pii/S2589004219302366

Address of the bookmark: https://github.com/AlgoLab/malva

Π-cyc: A Reference-free SNP Discovery Application using Parallel Graph Search

Jit — Tue, 28 Jan 2020 03:34:23 -0600

Reference free SNP search for comparative population genomics: multiple samples run simultanously. **experimental phase, compiles and runs with OpenMPI-1.8.8 with Intel Compiler only

Cycles enumeration (aka Bubbles) as part of de novo de bruijn graphs assembly using colours can be unpractical for large error prone genomes which makes the assembly process produce an excessive number of false positive cycles. Our solution is to search the graph in multicores shared memory parallel mode using graph decomposition then use filtering method to generate good quality SNPs.

https://arxiv.org/abs/1809.06700

https://github.com/redayounsi/2KP2P

/2kp2omp/bin/main_2kp2_K63_C2 -i fastq_files.txt -o fungus_bub.fasta -r stat_fungus.txt -c cov_fungus_hash.txt -k 63 -h 20 -b 100 -g 600 -l 100 -f 16 -t 5.0 -x 1 -v 0 -p 1 -y 1 -u 1

Address of the bookmark: https://github.com/redayounsi/2KP2P

FastGT: an alignment-free method for calling common SNVs directly from raw sequencing reads

Jit — Tue, 28 Jan 2020 03:27:33 -0600

FastGT is a program package for whole-genome genotyping of genome variants directly from raw sequencing reads. It is written in C and runs in Linux. FastGT uses a list of variant-specific k-mer pairs that are unique in human genome, counts the frequency of k-mers in sequencing data and predicts the genotype. All this takes less than 1 hour on average low-cost Linux server.

http://bioinfo.ut.ee/FastGT/

https://github.com/bioinfo-ut/GenomeTester4/

Address of the bookmark: http://bioinfo.ut.ee/FastGT/

Kevler: Reference-free variant discovery in large eukaryotic genomes

Jit — Tue, 28 Jan 2020 03:21:53 -0600

Welcome to kevlar, software for predicting de novo genetic variants without mapping reads to a reference genome! kevlar's k-mer abundance based method calls single nucleotide variants (SNVs), multinucleotide variants (MNVs), insertion/deletion variants (indels), and structural variants (SVs) simultaneously with a single simple model.

More at https://kevlar.readthedocs.io/en/latest/

https://www.cell.com/iscience/pdf/S2589-0042(19)30259-7.pdf

Address of the bookmark: https://github.com/kevlar-dev/kevlar

Genome in a Bottle (GIAB) Consortium

Jit — Sat, 25 Jan 2020 13:50:52 -0600

The Genome in a Bottle (GIAB) Consortium is a public-private-academic consortium hosted by NIST to develop the technical infrastructure (reference standards, reference methods, and reference data) to enable translation of whole human genome sequencing to clinical practice.

https://www.nist.gov/news-events/news/2016/09/nist-releases-new-family-standardized-genomes

Address of the bookmark: https://jimb.stanford.edu/giab/

DeepVariant : an analysis pipeline that uses a deep neural network to call genetic variants from next-generation DNA sequencing data.

Jit — Sat, 25 Jan 2020 13:28:09 -0600

DeepVariant is an analysis pipeline that uses a deep neural network to call genetic variants from next-generation DNA sequencing data.

DeepVariant is an analysis pipeline that uses a deep neural network to call genetic variants from next-generation DNA sequencing data. DeepVariant relies on Nucleus, a library of Python and C++ code for reading and writing data in common genomics file formats (like SAM and VCF) designed for painless integration with the TensorFlow machine learning framework.

https://ai.googleblog.com/2017/12/deepvariant-highly-accurate-genomes.html

https://www.biorxiv.org/content/10.1101/092890v6

Address of the bookmark: https://github.com/google/deepvariant

gapFinisher: A reliable gap filling pipeline for SSPACE-LongRead scaffolder output

Rahul Nayak — Fri, 24 Jan 2020 06:04:40 -0600

gapFinisher is based on the controlled use of a previously published gap filling tool FGAP and works on all standard Linux/UNIX command lines. They compare the performance of gapFinisher against two other published gap filling tools PBJelly and GMcloser.

gapFinisher can fill gaps in draft genomes quickly and reliably.

Address of the bookmark: https://github.com/kammoji/gapFinisher