Followings are the previous year paper of BINC Exam….  

ROUND 2

Q1. Write a program to take input from user a dna sequence and delete a base at  
   position (also given by the user).

Q2. Write a program to take input from user a sequence and add a motif at the left hand 
   side of the sequence. Motif also has to be taken from the use.

Q3. Explain briefly principle of PCR amplification of a gene

Q4. Explain How RFLP is used to find diversity between species

Q5. $a=ATGGCGTGCATCGTGACAGTCCTAGGTGCTACAGTGTGTGTGTCACTACG

find d probability of finding A at d first position of the codon (codon selection starts from 1st position).

Q6. Write various methods of MSA........compare hamming distance n one more  model ( i 
   forgot).....how to find accuracy of phylogenetic tree.......

Q7. find d frequency of aromatic n charged amino acid..............

Q8. antigen-antibody interaction is special type of protein-2 interaction..y????
    give n algo for findin epitope .......

Q9. malaria virus is havin genome.....give its importance.......find a schema in order to 
   develope a drug........n how bioinfo databases r important 4 it........

Q10. find x,y & z value for the system havin 3 equations(3 linear eq in x,y& z were given)
     use sympson rule to find d integration value n den compare d value wid xact value(one       
     integration was given)

Q11. MO diagram of H2 n H2+,find its bond order also
      B<=>A<=>C,<=> stands for reversible reaction,find d energy profile diagram n find  
      d relatiion b/w k1,k2,k3,k4(k1 is for a->b k2 b->a k3a->c k4c->a)