<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: All site pages]]></title>
	<link>https://bioinformaticsonline.com/pages/all?offset=40</link>
	<atom:link href="https://bioinformaticsonline.com/pages/all?offset=40" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36373/tools-to-predict-the-impact-of-missense-variants</guid>
	<pubDate>Mon, 23 Apr 2018 12:57:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36373/tools-to-predict-the-impact-of-missense-variants</link>
	<title><![CDATA[Tools to Predict the Impact of Missense Variants !]]></title>
	<description><![CDATA[<p><span>Prioritizing missense variants for further experimental investigation is a key challenge in current sequencing studies for exploring complex and Mendelian diseases. A large number of&nbsp;</span><em>in silico</em><span>&nbsp;tools have been employed for the task of pathogenicity prediction, including PolyPhen‐2, SIFT, FatHMM, MutationTaster‐2, MutationAssessor, Combined Annotation Dependent Depletion, LRT, phyloP, and GERP++, as well as optimized methods of combining tool scores, such as Condel and Logit. Due to the wealth of these methods, an important practical question to answer is which of these tools generalize best, that is, correctly predict the pathogenic character of new variants. </span></p><p><span>Study of 10 tools on five datasets that such a comparative evaluation of these tools is hindered by two types of circularity: they arise due to (1) the same variants or (2) different variants from the same protein occurring both in the datasets used for training and for evaluation of these tools, which may lead to overly optimistic results. Comparative evaluations of predictors that do not address these types of circularity may erroneously conclude that circularity confounded tools are most accurate among all tools, and may even outperform optimized combinations of tools.</span></p><p><span>Following tools are useful for mis sense muation detection ...&nbsp;</span></p><p>PolyPhen‐2 (PP2)<br />&ldquo;Predicts possible impact of an amino acid substitution on the structure and function of a human protein using straightforward physical and comparative considerations&rdquo;</p><p>MutationTaster‐2 (MT2)<br />&ldquo;Evaluation of the disease‐causing potential of DNA sequence alterations&rdquo;</p><p>MutationAssessor (MASS)<br />&ldquo;Predicts the functional impact of amino acid substitutions in proteins, such as mutations discovered in cancer or missense polymorphisms&rdquo;</p><p>LRT<br />&ldquo;Identify a subset of deleterious mutations that disrupt highly conserved amino acids within protein‐coding sequences, which are likely to be unconditionally deleterious&rdquo;</p><p>SIFT<br />&ldquo;Predicts whether an amino acid substitution affects protein function&rdquo;</p><p>GERP++<br />&ldquo;Identifies constrained elements in multiple alignments by quantifying substitution deficits. These deficits represent substitutions that would have occurred if the element were neutral DNA, but did not occur because the element has been under functional constraint. We refer to these deficits as &ldquo;rejected substitutions.&rdquo; Rejected substitutions are a natural measure of constraint that reflects the strength of past purifying selection on the element&rdquo;</p><p>phyloP<br />&ldquo;Compute conservation or acceleration P values based on an alignment and a model of neutral evolution&rdquo;</p><p>FatHMM unweighted (FatHMM‐U)<br />Predicts &ldquo;functional consequences of both coding variants, that is, nonsynonymous single‐nucleotide variants, and noncoding variants&rdquo;</p><p>FatHMM weighted (FatHMM‐W)<br />Predicts &ldquo;functional consequences of both coding variants, that is, nonsynonymous single‐nucleotide variants, and noncoding variants&rdquo; and its weighting scheme attributes higher tolerance scores to SNVs in proteins, related proteins, or domains that already include a high fraction of pathogenic variantsh</p><p>Combined Annotation Dependent Depletion (CADD)<br />&ldquo;CADD is a tool for scoring the deleteriousness of single‐nucleotide variants as well as insertion/deletions variants in the human genome&rdquo;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</guid>
	<pubDate>Tue, 10 Apr 2018 04:13:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</link>
	<title><![CDATA[Bioinformatics OneLiner]]></title>
	<description><![CDATA[<p>To remove all line ends (\n) from a Unix text file:</p><pre>sed ':a;N;$!ba;s/\n//g' filename.txt &gt; newfilename_oneline.txt</pre><p>To get average for a column of numbers (here the second column $2):</p><pre>awk '{ sum += $2; n++ } END { if (n &gt; 0) print sum / n; }'</pre><p>To get sequence length for all sequences in a fasta file:</p><pre>awk '/^&gt;/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen = seqlen +length($0)}END{print seqlen}' \<br />filename.fasta</pre><p>To copy (move, rename, etc) files based on their list in a text file:</p><pre>cat file_list.txt | while read line; do cp "$line" complete_dataset/"$line"; done</pre><p>To split bam files into sets with mapped and unmapped reads:</p><pre>samtools view -F4 sample.bam &gt; sample.mapped.sam<br />samtools view -f4 sample.bam &gt; sample.unmapped.sam</pre><p>To gzip all your fastq files using gnu parallel and gzip:</p><pre>parallel gzip ::: *.fastq</pre><p>To gzip all your fastq files using pigz:</p><pre>pigz *.fastq</pre><p>To count all sequences in a fasta file:</p><pre>grep "^&gt;" yourfile.fasta -c</pre><p>To count all sequences in all fasta files in your current directory:</p><pre>for a in *.fasta; do ls $a; grep "^&gt;" -c $a; done</pre><p>To keep only one copy of duplicated lines:</p><pre>awk '!seen[$0]++'</pre><p>To sum assembly size from SPAdes contigs.fasta or scaffolds.fasta file:</p><pre>grep "^&gt;" scaffolds.fasta | cut -f 4 -d '_' | paste -sd+ | bc</pre><p>To remove everything after the first space at each line, e.g. to to simplify fasta headers:</p><pre>cut -d' ' -f1 &lt; your_file</pre><p>To count reads in a all .fastq.gz files in your current folder (fast, using gnu parallel):</p><pre>parallel "echo {} &amp;&amp; gunzip -c {} | wc -l | awk '{d=\$1; print d/4;}'" ::: *.gz</pre><p>To count reads in a all .fastq.gz files in your current folder:</p><pre>zcat *.gz | echo $((`wc -l`/4))</pre><p>To count reads in a all .fastq files in your current folder:</p><pre>cat *.fastq | echo $((`wc -l`/4))</pre><p>To count base pairs in a all .fastq.gz files in your current folder:</p><pre>zcat *.fastq.gz | paste - - - - | cut -f 2 | tr -d '\n' | wc -c </pre><p>To split multifasta file into many fasta files:</p><pre>awk '/^&gt;/ {OUT=substr($0,2) ".fa"}; {print &gt;&gt; OUT; close(OUT)}' Input_File</pre><p>To convert Illumina FASTQ 1.3 to 1.8:</p><pre>sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&amp;'\''()*+,-.\/0123456789:;&lt;=&gt;?@ABCDEFGHIJ/' f.fastq</pre><p>To convert FASTQ to FASTA:</p><pre>sed -n '1~4s/^@/&gt;/p;2~4p' </pre><p>To get fastq read length distribution:</p><pre>cat reads.fastq | awk '{if(NR%4==2) print length($1)}' | sort | uniq -c</pre><p>To deinterleave interleaved fastq file:</p><pre>cat myf.fq | paste - - - - - - - - | tee &gt;(cut -f 1-4 | tr "\t" "\n" &gt; myfile_1.fq) | cut -f 5-8 | \<br />tr "\t" "\n" &gt; myf2.fq </pre><p>To filter and sort contig identifiers from SPAdes assembly (e.g. here lenght &gt;= 4000 + coverage &gt;=100):</p><pre>grep "^&gt;" scaffolds.fasta | sed s"/_/ /"g | awk '{ if ($4 &gt;= 4000 &amp;&amp; $6 &gt;= 100) print $0 }' | sort -k 4 -n | \<br />sed s"/ /_/"g</pre><p>To append something to all headers of your fasta files:</p><pre>sed 's/&gt;.*/&amp;YOURSTRING/' filename.fasta &gt; new_filename.fasta</pre><p>To replace/squeeze multiple adjacent spaces by only one space:&nbsp;</p><pre>tr -s " " &lt; file</pre><p>To filter fastq based on length (here larger than or equal to 21, but smaller than or equal to 25.</p><pre>cat your.fastq | paste - - - - | awk 'length($2)&nbsp; &gt;= 21 &amp;&amp; length($2) &lt;= 25' | sed 's/\t/\n/g' &gt; filtered.fastq</pre><p>To print difference between the last and first row in 5th column:</p><pre>awk '{if (!first){first=$5;}; last=$5;} END {print last-first}' myfile.txt</pre><p>To sample only 200 first bases from all sequences in a multifasta file (e.g. from assembly scaffolds.fasta file here):</p><pre>awk '/^&gt;/{ seqlen=0; print; next; } seqlen &lt; 200 { if (seqlen + length($0) &gt; 200) $0 = substr($0, 1, 200-seqlen);\<br /> seqlen += length($0); print }' scaffolds.fasta &gt; 200bp_scaffolds.fasta</pre><p>&nbsp;To pipe a compressed fasta file directly into makeblastdb.</p><pre>gunzip -c fasta.gz | makeblastdb -in -</pre><p>To remove sequences with duplicate fasta headers from a fasta file.</p><pre>awk '/^&gt;/{f=!d[$1];d[$1]=1}f' in.fasta &gt; out.fasta</pre>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36185/installing-bioscf-perl-module</guid>
	<pubDate>Mon, 09 Apr 2018 04:04:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36185/installing-bioscf-perl-module</link>
	<title><![CDATA[Installing Bio::SCF perl module]]></title>
	<description><![CDATA[<p>Most Perl modules are written in Perl, some use&nbsp;<a href="http://perldoc.perl.org/perlxs.html">XS</a>&nbsp;(they are written in&nbsp;<a href="http://en.wikipedia.org/wiki/C_(programming_language)">C</a>) so require a C&nbsp;<a href="http://en.wikipedia.org/wiki/Compiler">compiler</a>&nbsp;(it's easy to get this setup - don't panic), see your OS of choice below to find out how to get the right compiler. Modules may have dependencies on other modules (almost always on&nbsp;<a href="http://www.cpan.org/">CPAN</a>) and cannot be installed without them (or without a specific version of them). Many modules on CPAN require a somewhat recent version of Perl (version 5.8 or above).</p><p>More about the basic perl module installation steps check this&nbsp;http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</p><p>installing Bio::SCF perl module is daunting task, specieally because of it dependencies. Here is the steps, you need to follow to sucessfully install Bio::SCF module</p><p>#sudo apt-get install libbio-scf-perl #trev for visualization of scf file</p><p><strong>1. You will need the zlib library which can be found at http://www.zlib.net/.</strong></p><p>install zlib library first:</p><p>jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] ./configure []<br />Checking for gcc...<br />Checking for shared library support...<br />Building shared library libz.so.1.2.11 with gcc.<br />Checking for size_t... Yes.<br />Checking for off64_t... Yes.<br />Checking for fseeko... Yes.<br />Checking for strerror... Yes.<br />Checking for unistd.h... Yes.<br />Checking for stdarg.h... Yes.<br />Checking whether to use vs[n]printf() or s[n]printf()... using vs[n]printf().<br />Checking for vsnprintf() in stdio.h... Yes.<br />Checking for return value of vsnprintf()... Yes.<br />Checking for attribute(visibility) support... Yes.<br />jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] make []<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o example.o test/example.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o adler32.o adler32.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o crc32.o crc32.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o deflate.o deflate.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o infback.o infback.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inffast.o inffast.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inflate.o inflate.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inftrees.o inftrees.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o trees.o trees.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o zutil.o zutil.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o compress.o compress.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o uncompr.o uncompr.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzclose.o gzclose.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzlib.o gzlib.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzread.o gzread.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzwrite.o gzwrite.c<br />ar rc libz.a adler32.o crc32.o deflate.o infback.o inffast.o inflate.o inftrees.o trees.o zutil.o compress.o uncompr.o gzclose.o gzlib.o gzread.o gzwrite.o <br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example example.o -L. libz.a<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o minigzip.o test/minigzip.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip minigzip.o -L. libz.a<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/adler32.o adler32.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/crc32.o crc32.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/deflate.o deflate.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/infback.o infback.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inffast.o inffast.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inflate.o inflate.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inftrees.o inftrees.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/trees.o trees.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/zutil.o zutil.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/compress.o compress.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/uncompr.o uncompr.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzclose.o gzclose.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzlib.o gzlib.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzread.o gzread.c<br />gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzwrite.o gzwrite.c<br />gcc -shared -Wl,-soname,libz.so.1,--version-script,zlib.map -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o libz.so.1.2.11 adler32.lo crc32.lo deflate.lo infback.lo inffast.lo inflate.lo inftrees.lo trees.lo zutil.lo compress.lo uncompr.lo gzclose.lo gzlib.lo gzread.lo gzwrite.lo -lc <br />rm -f libz.so libz.so.1<br />ln -s libz.so.1.2.11 libz.so<br />ln -s libz.so.1.2.11 libz.so.1<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o examplesh example.o -L. libz.so.1.2.11<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzipsh minigzip.o -L. libz.so.1.2.11<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o example64.o test/example.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example64 example64.o -L. libz.a<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o minigzip64.o test/minigzip.c<br />gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip64 minigzip64.o -L. libz.a<br />jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] sudo make install []<br />[sudo] password for jitendra: <br />rm -f /usr/local/lib/libz.a<br />cp libz.a /usr/local/lib<br />chmod 644 /usr/local/lib/libz.a<br />cp libz.so.1.2.11 /usr/local/lib<br />chmod 755 /usr/local/lib/libz.so.1.2.11<br />rm -f /usr/local/share/man/man3/zlib.3<br />cp zlib.3 /usr/local/share/man/man3<br />chmod 644 /usr/local/share/man/man3/zlib.3<br />rm -f /usr/local/lib/pkgconfig/zlib.pc<br />cp zlib.pc /usr/local/lib/pkgconfig<br />chmod 644 /usr/local/lib/pkgconfig/zlib.pc<br />rm -f /usr/local/include/zlib.h /usr/local/include/zconf.h<br />cp zlib.h zconf.h /usr/local/include<br />chmod 644 /usr/local/include/zlib.h /usr/local/include/zconf.h<br />&nbsp;</p><p><br /><strong>2. Now make io_lib-1.9</strong></p><p>In order to install this perl extension you have to install io-lib version 1.9 or higher from the Staden library (staden.sourceforge.net). This can be downloaded from https://sourceforge.net/project/showfiles.php?group_id=100316&amp;package_id=108243&amp;release_id=340318 confirm that the package installed correctly look for a library named "libread".</p><p>jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] export CFLAGS="-fPIC" &amp;&amp; ./configure <br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for gcc... gcc<br />checking for C compiler default output file name... a.out<br />checking whether the C compiler works... yes<br />checking whether we are cross compiling... no<br />checking for suffix of executables... <br />checking for suffix of object files... o<br />checking whether we are using the GNU C compiler... yes<br />checking whether gcc accepts -g... yes<br />checking for gcc option to accept ANSI C... none needed<br />checking for style of include used by make... GNU<br />checking dependency style of gcc... gcc3<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking for ranlib... ranlib<br />checking for main in -lz... yes<br />checking how to run the C preprocessor... gcc -E<br />checking for egrep... grep -E<br />checking for ANSI C header files... yes<br />checking for sys/wait.h that is POSIX.1 compatible... yes<br />checking for sys/types.h... yes<br />checking for sys/stat.h... yes<br />checking for stdlib.h... yes<br />checking for string.h... yes<br />checking for memory.h... yes<br />checking for strings.h... yes<br />checking for inttypes.h... yes<br />checking for stdint.h... yes<br />checking for unistd.h... yes<br />checking fcntl.h usability... yes<br />checking fcntl.h presence... yes<br />checking for fcntl.h... yes<br />checking limits.h usability... yes<br />checking limits.h presence... yes<br />checking for limits.h... yes<br />checking for unistd.h... (cached) yes<br />checking zlib.h usability... yes<br />checking zlib.h presence... yes<br />checking for zlib.h... yes<br />checking whether byte ordering is bigendian... no<br />checking for short... yes<br />checking size of short... 2<br />checking for int... yes<br />checking size of int... 4<br />checking for long... yes<br />checking size of long... 8<br />checking for inline... inline<br />checking for mode_t... yes<br />checking build system type... x86_64-unknown-linux-gnu<br />checking host system type... x86_64-unknown-linux-gnu<br />checking for cos in -lm... yes<br />checking for strdup... yes<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating read/Makefile<br />config.status: creating progs/Makefile<br />config.status: creating config.h<br />config.status: executing depfiles commands<br />jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] make []<br />make all-recursive<br />make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />Making all in read<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT Read.o -MD -MP -MF ".deps/Read.Tpo" -c -o Read.o Read.c; \<br />then mv -f ".deps/Read.Tpo" ".deps/Read.Po"; else rm -f ".deps/Read.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_extras.o -MD -MP -MF ".deps/scf_extras.Tpo" -c -o scf_extras.o scf_extras.c; \<br />then mv -f ".deps/scf_extras.Tpo" ".deps/scf_extras.Po"; else rm -f ".deps/scf_extras.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT translate.o -MD -MP -MF ".deps/translate.Tpo" -c -o translate.o translate.c; \<br />then mv -f ".deps/translate.Tpo" ".deps/translate.Po"; else rm -f ".deps/translate.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compression.o -MD -MP -MF ".deps/compression.Tpo" -c -o compression.o `test -f '../ztr/compression.c' || echo './'`../ztr/compression.c; \<br />then mv -f ".deps/compression.Tpo" ".deps/compression.Po"; else rm -f ".deps/compression.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr.o -MD -MP -MF ".deps/ztr.Tpo" -c -o ztr.o `test -f '../ztr/ztr.c' || echo './'`../ztr/ztr.c; \<br />then mv -f ".deps/ztr.Tpo" ".deps/ztr.Po"; else rm -f ".deps/ztr.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr_translate.o -MD -MP -MF ".deps/ztr_translate.Tpo" -c -o ztr_translate.o `test -f '../ztr/ztr_translate.c' || echo './'`../ztr/ztr_translate.c; \<br />then mv -f ".deps/ztr_translate.Tpo" ".deps/ztr_translate.Po"; else rm -f ".deps/ztr_translate.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT fpoint.o -MD -MP -MF ".deps/fpoint.Tpo" -c -o fpoint.o `test -f '../abi/fpoint.c' || echo './'`../abi/fpoint.c; \<br />then mv -f ".deps/fpoint.Tpo" ".deps/fpoint.Po"; else rm -f ".deps/fpoint.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOABI.o -MD -MP -MF ".deps/seqIOABI.Tpo" -c -o seqIOABI.o `test -f '../abi/seqIOABI.c' || echo './'`../abi/seqIOABI.c; \<br />then mv -f ".deps/seqIOABI.Tpo" ".deps/seqIOABI.Po"; else rm -f ".deps/seqIOABI.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOALF.o -MD -MP -MF ".deps/seqIOALF.Tpo" -c -o seqIOALF.o `test -f '../alf/seqIOALF.c' || echo './'`../alf/seqIOALF.c; \<br />then mv -f ".deps/seqIOALF.Tpo" ".deps/seqIOALF.Po"; else rm -f ".deps/seqIOALF.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ctfCompress.o -MD -MP -MF ".deps/ctfCompress.Tpo" -c -o ctfCompress.o `test -f '../ctf/ctfCompress.c' || echo './'`../ctf/ctfCompress.c; \<br />then mv -f ".deps/ctfCompress.Tpo" ".deps/ctfCompress.Po"; else rm -f ".deps/ctfCompress.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOCTF.o -MD -MP -MF ".deps/seqIOCTF.Tpo" -c -o seqIOCTF.o `test -f '../ctf/seqIOCTF.c' || echo './'`../ctf/seqIOCTF.c; \<br />then mv -f ".deps/seqIOCTF.Tpo" ".deps/seqIOCTF.Po"; else rm -f ".deps/seqIOCTF.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT expFileIO.o -MD -MP -MF ".deps/expFileIO.Tpo" -c -o expFileIO.o `test -f '../exp_file/expFileIO.c' || echo './'`../exp_file/expFileIO.c; \<br />then mv -f ".deps/expFileIO.Tpo" ".deps/expFileIO.Po"; else rm -f ".deps/expFileIO.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOPlain.o -MD -MP -MF ".deps/seqIOPlain.Tpo" -c -o seqIOPlain.o `test -f '../plain/seqIOPlain.c' || echo './'`../plain/seqIOPlain.c; \<br />then mv -f ".deps/seqIOPlain.Tpo" ".deps/seqIOPlain.Po"; else rm -f ".deps/seqIOPlain.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT misc_scf.o -MD -MP -MF ".deps/misc_scf.Tpo" -c -o misc_scf.o `test -f '../scf/misc_scf.c' || echo './'`../scf/misc_scf.c; \<br />then mv -f ".deps/misc_scf.Tpo" ".deps/misc_scf.Po"; else rm -f ".deps/misc_scf.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_scf.o -MD -MP -MF ".deps/read_scf.Tpo" -c -o read_scf.o `test -f '../scf/read_scf.c' || echo './'`../scf/read_scf.c; \<br />then mv -f ".deps/read_scf.Tpo" ".deps/read_scf.Po"; else rm -f ".deps/read_scf.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT write_scf.o -MD -MP -MF ".deps/write_scf.Tpo" -c -o write_scf.o `test -f '../scf/write_scf.c' || echo './'`../scf/write_scf.c; \<br />then mv -f ".deps/write_scf.Tpo" ".deps/write_scf.Po"; else rm -f ".deps/write_scf.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT array.o -MD -MP -MF ".deps/array.Tpo" -c -o array.o `test -f '../utils/array.c' || echo './'`../utils/array.c; \<br />then mv -f ".deps/array.Tpo" ".deps/array.Po"; else rm -f ".deps/array.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compress.o -MD -MP -MF ".deps/compress.Tpo" -c -o compress.o `test -f '../utils/compress.c' || echo './'`../utils/compress.c; \<br />then mv -f ".deps/compress.Tpo" ".deps/compress.Po"; else rm -f ".deps/compress.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT error.o -MD -MP -MF ".deps/error.Tpo" -c -o error.o `test -f '../utils/error.c' || echo './'`../utils/error.c; \<br />then mv -f ".deps/error.Tpo" ".deps/error.Po"; else rm -f ".deps/error.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT files.o -MD -MP -MF ".deps/files.Tpo" -c -o files.o `test -f '../utils/files.c' || echo './'`../utils/files.c; \<br />then mv -f ".deps/files.Tpo" ".deps/files.Po"; else rm -f ".deps/files.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT find.o -MD -MP -MF ".deps/find.Tpo" -c -o find.o `test -f '../utils/find.c' || echo './'`../utils/find.c; \<br />then mv -f ".deps/find.Tpo" ".deps/find.Po"; else rm -f ".deps/find.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mach-io.o -MD -MP -MF ".deps/mach-io.Tpo" -c -o mach-io.o `test -f '../utils/mach-io.c' || echo './'`../utils/mach-io.c; \<br />then mv -f ".deps/mach-io.Tpo" ".deps/mach-io.Po"; else rm -f ".deps/mach-io.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT open_trace_file.o -MD -MP -MF ".deps/open_trace_file.Tpo" -c -o open_trace_file.o `test -f '../utils/open_trace_file.c' || echo './'`../utils/open_trace_file.c; \<br />then mv -f ".deps/open_trace_file.Tpo" ".deps/open_trace_file.Po"; else rm -f ".deps/open_trace_file.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_alloc.o -MD -MP -MF ".deps/read_alloc.Tpo" -c -o read_alloc.o `test -f '../utils/read_alloc.c' || echo './'`../utils/read_alloc.c; \<br />then mv -f ".deps/read_alloc.Tpo" ".deps/read_alloc.Po"; else rm -f ".deps/read_alloc.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT strings.o -MD -MP -MF ".deps/strings.Tpo" -c -o strings.o `test -f '../utils/strings.c' || echo './'`../utils/strings.c; \<br />then mv -f ".deps/strings.Tpo" ".deps/strings.Po"; else rm -f ".deps/strings.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT traceType.o -MD -MP -MF ".deps/traceType.Tpo" -c -o traceType.o `test -f '../utils/traceType.c' || echo './'`../utils/traceType.c; \<br />then mv -f ".deps/traceType.Tpo" ".deps/traceType.Po"; else rm -f ".deps/traceType.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT xalloc.o -MD -MP -MF ".deps/xalloc.Tpo" -c -o xalloc.o `test -f '../utils/xalloc.c' || echo './'`../utils/xalloc.c; \<br />then mv -f ".deps/xalloc.Tpo" ".deps/xalloc.Po"; else rm -f ".deps/xalloc.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT vlen.o -MD -MP -MF ".deps/vlen.Tpo" -c -o vlen.o `test -f '../utils/vlen.c' || echo './'`../utils/vlen.c; \<br />then mv -f ".deps/vlen.Tpo" ".deps/vlen.Po"; else rm -f ".deps/vlen.Tpo"; exit 1; fi<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_table.o -MD -MP -MF ".deps/hash_table.Tpo" -c -o hash_table.o `test -f '../utils/hash_table.c' || echo './'`../utils/hash_table.c; \<br />then mv -f ".deps/hash_table.Tpo" ".deps/hash_table.Po"; else rm -f ".deps/hash_table.Tpo"; exit 1; fi<br />../utils/hash_table.c: In function &lsquo;HashFileOpen&rsquo;:<br />../utils/hash_table.c:920:21: warning: field precision specifier &lsquo;.*&rsquo; expects argument of type &lsquo;int&rsquo;, but argument 3 has type &lsquo;long int&rsquo; [-Wformat=]<br /> sprintf(aname, "%.*s%s", cp-fname+1, fname, hf-&gt;archive);<br /> ^<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mFILE.o -MD -MP -MF ".deps/mFILE.Tpo" -c -o mFILE.o `test -f '../utils/mFILE.c' || echo './'`../utils/mFILE.c; \<br />then mv -f ".deps/mFILE.Tpo" ".deps/mFILE.Po"; else rm -f ".deps/mFILE.Tpo"; exit 1; fi<br />rm -f libread.a<br />ar cru libread.a Read.o scf_extras.o translate.o compression.o ztr.o ztr_translate.o fpoint.o seqIOABI.o seqIOALF.o ctfCompress.o seqIOCTF.o expFileIO.o seqIOPlain.o misc_scf.o read_scf.o write_scf.o array.o compress.o error.o files.o find.o mach-io.o open_trace_file.o read_alloc.o strings.o traceType.o xalloc.o vlen.o hash_table.o mFILE.o <br />ar: `u' modifier ignored since `D' is the default (see `U')<br />ranlib libread.a<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />Making all in progs<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT convert_trace.o -MD -MP -MF ".deps/convert_trace.Tpo" -c -o convert_trace.o convert_trace.c; \<br />then mv -f ".deps/convert_trace.Tpo" ".deps/convert_trace.Po"; else rm -f ".deps/convert_trace.Tpo"; exit 1; fi<br />gcc -fPIC -o convert_trace convert_trace.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT makeSCF.o -MD -MP -MF ".deps/makeSCF.Tpo" -c -o makeSCF.o makeSCF.c; \<br />then mv -f ".deps/makeSCF.Tpo" ".deps/makeSCF.Po"; else rm -f ".deps/makeSCF.Tpo"; exit 1; fi<br />gcc -fPIC -o makeSCF makeSCF.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT extract_seq.o -MD -MP -MF ".deps/extract_seq.Tpo" -c -o extract_seq.o extract_seq.c; \<br />then mv -f ".deps/extract_seq.Tpo" ".deps/extract_seq.Po"; else rm -f ".deps/extract_seq.Tpo"; exit 1; fi<br />gcc -fPIC -o extract_seq extract_seq.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT index_tar.o -MD -MP -MF ".deps/index_tar.Tpo" -c -o index_tar.o index_tar.c; \<br />then mv -f ".deps/index_tar.Tpo" ".deps/index_tar.Po"; else rm -f ".deps/index_tar.Tpo"; exit 1; fi<br />gcc -fPIC -o index_tar index_tar.o <br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_dump.o -MD -MP -MF ".deps/scf_dump.Tpo" -c -o scf_dump.o scf_dump.c; \<br />then mv -f ".deps/scf_dump.Tpo" ".deps/scf_dump.Po"; else rm -f ".deps/scf_dump.Tpo"; exit 1; fi<br />gcc -fPIC -o scf_dump scf_dump.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_info.o -MD -MP -MF ".deps/scf_info.Tpo" -c -o scf_info.o scf_info.c; \<br />then mv -f ".deps/scf_info.Tpo" ".deps/scf_info.Po"; else rm -f ".deps/scf_info.Tpo"; exit 1; fi<br />gcc -fPIC -o scf_info scf_info.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_update.o -MD -MP -MF ".deps/scf_update.Tpo" -c -o scf_update.o scf_update.c; \<br />then mv -f ".deps/scf_update.Tpo" ".deps/scf_update.Po"; else rm -f ".deps/scf_update.Tpo"; exit 1; fi<br />gcc -fPIC -o scf_update scf_update.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT get_comment.o -MD -MP -MF ".deps/get_comment.Tpo" -c -o get_comment.o get_comment.c; \<br />then mv -f ".deps/get_comment.Tpo" ".deps/get_comment.Po"; else rm -f ".deps/get_comment.Tpo"; exit 1; fi<br />gcc -fPIC -o get_comment get_comment.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_tar.o -MD -MP -MF ".deps/hash_tar.Tpo" -c -o hash_tar.o hash_tar.c; \<br />then mv -f ".deps/hash_tar.Tpo" ".deps/hash_tar.Po"; else rm -f ".deps/hash_tar.Tpo"; exit 1; fi<br />gcc -fPIC -o hash_tar hash_tar.o ../read/libread.a -lz -lm <br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_extract.o -MD -MP -MF ".deps/hash_extract.Tpo" -c -o hash_extract.o hash_extract.c; \<br />then mv -f ".deps/hash_extract.Tpo" ".deps/hash_extract.Po"; else rm -f ".deps/hash_extract.Tpo"; exit 1; fi<br />gcc -fPIC -o hash_extract hash_extract.o ../read/libread.a -lz -lm <br />if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT trace_dump.o -MD -MP -MF ".deps/trace_dump.Tpo" -c -o trace_dump.o trace_dump.c; \<br />then mv -f ".deps/trace_dump.Tpo" ".deps/trace_dump.Po"; else rm -f ".deps/trace_dump.Tpo"; exit 1; fi<br />gcc -fPIC -o trace_dump trace_dump.o ../read/libread.a -lz -lm <br />../read/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'<br /><br />jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] sudo make install []<br />[sudo] password for jitendra: <br />Making install in read<br />make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />test -z "/usr/local/lib" || mkdir -p -- "/usr/local/lib"<br /> /usr/bin/install -c -m 644 'libread.a' '/usr/local/lib/libread.a'<br /> ranlib '/usr/local/lib/libread.a'<br />make[2]: Nothing to be done for 'install-data-am'.<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'<br />Making install in progs<br />make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />test -z "/usr/local/bin" || mkdir -p -- "/usr/local/bin"<br /> /usr/bin/install -c 'convert_trace' '/usr/local/bin/convert_trace'<br /> /usr/bin/install -c 'makeSCF' '/usr/local/bin/makeSCF'<br /> /usr/bin/install -c 'extract_seq' '/usr/local/bin/extract_seq'<br /> /usr/bin/install -c 'index_tar' '/usr/local/bin/index_tar'<br /> /usr/bin/install -c 'scf_dump' '/usr/local/bin/scf_dump'<br /> /usr/bin/install -c 'scf_info' '/usr/local/bin/scf_info'<br /> /usr/bin/install -c 'scf_update' '/usr/local/bin/scf_update'<br /> /usr/bin/install -c 'get_comment' '/usr/local/bin/get_comment'<br /> /usr/bin/install -c 'hash_tar' '/usr/local/bin/hash_tar'<br /> /usr/bin/install -c 'hash_extract' '/usr/local/bin/hash_extract'<br /> /usr/bin/install -c 'trace_dump' '/usr/local/bin/trace_dump'<br />make[2]: Nothing to be done for 'install-data-am'.<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'<br />make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />make[2]: Nothing to be done for 'install-exec-am'.<br />test -z "/usr/local/man/man3" || mkdir -p -- "/usr/local/man/man3"<br /> /usr/bin/install -c -m 644 './man/man3/exp2read.3' '/usr/local/man/man3/exp2read.3'<br /> /usr/bin/install -c -m 644 './man/man3/ExperimentFile.3' '/usr/local/man/man3/ExperimentFile.3'<br /> /usr/bin/install -c -m 644 './man/man3/fread_reading.3' '/usr/local/man/man3/fread_reading.3'<br /> /usr/bin/install -c -m 644 './man/man3/fread_scf.3' '/usr/local/man/man3/fread_scf.3'<br /> /usr/bin/install -c -m 644 './man/man3/fwrite_reading.3' '/usr/local/man/man3/fwrite_reading.3'<br /> /usr/bin/install -c -m 644 './man/man3/fwrite_scf.3' '/usr/local/man/man3/fwrite_scf.3'<br /> /usr/bin/install -c -m 644 './man/man3/read2exp.3' '/usr/local/man/man3/read2exp.3'<br /> /usr/bin/install -c -m 644 './man/man3/read2scf.3' '/usr/local/man/man3/read2scf.3'<br /> /usr/bin/install -c -m 644 './man/man3/read_allocate.3' '/usr/local/man/man3/read_allocate.3'<br /> /usr/bin/install -c -m 644 './man/man3/read_deallocate.3' '/usr/local/man/man3/read_deallocate.3'<br /> /usr/bin/install -c -m 644 './man/man3/read_reading.3' '/usr/local/man/man3/read_reading.3'<br /> /usr/bin/install -c -m 644 './man/man3/read_scf.3' '/usr/local/man/man3/read_scf.3'<br /> /usr/bin/install -c -m 644 './man/man3/read_scf_header.3' '/usr/local/man/man3/read_scf_header.3'<br /> /usr/bin/install -c -m 644 './man/man3/scf2read.3' '/usr/local/man/man3/scf2read.3'<br /> /usr/bin/install -c -m 644 './man/man3/write_reading.3' '/usr/local/man/man3/write_reading.3'<br /> /usr/bin/install -c -m 644 './man/man3/write_scf.3' '/usr/local/man/man3/write_scf.3'<br /> /usr/bin/install -c -m 644 './man/man3/write_scf_header.3' '/usr/local/man/man3/write_scf_header.3'<br />test -z "/usr/local/man/man4" || mkdir -p -- "/usr/local/man/man4"<br /> /usr/bin/install -c -m 644 './man/man4/Read.4' '/usr/local/man/man4/Read.4'<br />test -z "/usr/local/include/io_lib" || mkdir -p -- "/usr/local/include/io_lib"<br /> /usr/bin/install -c -m 644 'read/Read.h' '/usr/local/include/io_lib/Read.h'<br /> /usr/bin/install -c -m 644 'read/scf_extras.h' '/usr/local/include/io_lib/scf_extras.h'<br /> /usr/bin/install -c -m 644 'read/translate.h' '/usr/local/include/io_lib/translate.h'<br /> /usr/bin/install -c -m 644 'abi/abi.h' '/usr/local/include/io_lib/abi.h'<br /> /usr/bin/install -c -m 644 'abi/fpoint.h' '/usr/local/include/io_lib/fpoint.h'<br /> /usr/bin/install -c -m 644 'abi/seqIOABI.h' '/usr/local/include/io_lib/seqIOABI.h'<br /> /usr/bin/install -c -m 644 'alf/alf.h' '/usr/local/include/io_lib/alf.h'<br /> /usr/bin/install -c -m 644 'ctf/seqIOCTF.h' '/usr/local/include/io_lib/seqIOCTF.h'<br /> /usr/bin/install -c -m 644 'exp_file/expFileIO.h' '/usr/local/include/io_lib/expFileIO.h'<br /> /usr/bin/install -c -m 644 'plain/plain.h' '/usr/local/include/io_lib/plain.h'<br /> /usr/bin/install -c -m 644 'scf/scf.h' '/usr/local/include/io_lib/scf.h'<br /> /usr/bin/install -c -m 644 'utils/array.h' '/usr/local/include/io_lib/array.h'<br /> /usr/bin/install -c -m 644 'utils/compress.h' '/usr/local/include/io_lib/compress.h'<br /> /usr/bin/install -c -m 644 'utils/error.h' '/usr/local/include/io_lib/error.h'<br /> /usr/bin/install -c -m 644 'utils/mach-io.h' '/usr/local/include/io_lib/mach-io.h'<br /> /usr/bin/install -c -m 644 'utils/misc.h' '/usr/local/include/io_lib/misc.h'<br /> /usr/bin/install -c -m 644 'utils/open_trace_file.h' '/usr/local/include/io_lib/open_trace_file.h'<br /> /usr/bin/install -c -m 644 'utils/tar_format.h' '/usr/local/include/io_lib/tar_format.h'<br /> /usr/bin/install -c -m 644 'utils/traceType.h' '/usr/local/include/io_lib/traceType.h'<br /> /usr/bin/install -c -m 644 'utils/xalloc.h' '/usr/local/include/io_lib/xalloc.h'<br /> /usr/bin/install -c -m 644 'utils/mFILE.h' '/usr/local/include/io_lib/mFILE.h'<br /> /usr/bin/install -c -m 644 'utils/stdio_hack.h' '/usr/local/include/io_lib/stdio_hack.h'<br /> /usr/bin/install -c -m 644 'utils/vlen.h' '/usr/local/include/io_lib/vlen.h'<br /> /usr/bin/install -c -m 644 'utils/hash_table.h' '/usr/local/include/io_lib/hash_table.h'<br /> /usr/bin/install -c -m 644 'utils/os.h' '/usr/local/include/io_lib/os.h'<br /> /usr/bin/install -c -m 644 'ztr/compression.h' '/usr/local/include/io_lib/compression.h'<br /> /usr/bin/install -c -m 644 'ztr/ztr.h' '/usr/local/include/io_lib/ztr.h'<br />make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'<br />make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'</p><p><strong>3. Now install Bio::SCF</strong></p><p>Now follows these steps:</p><p>tar zxf Bio::SCF.tar<br />cd Bio::SCF<br />perl Makefile.PL<br />make<br />make test<br />make install</p><p>jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] perl Makefile.PL []<br />Checking if your kit is complete...<br />Looks good<br />Generating a Unix-style Makefile<br />Writing Makefile for Bio::SCF<br />Writing MYMETA.yml and MYMETA.json<br />jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] make []<br />cp SCF.pm blib/lib/Bio/SCF.pm<br />cp SCF/Arrays.pm blib/lib/Bio/SCF/Arrays.pm<br />Running Mkbootstrap for Bio::SCF ()<br />chmod 644 "SCF.bs"<br />"/usr/bin/perl" "/usr/share/perl/5.22/ExtUtils/xsubpp" -typemap "/usr/share/perl/5.22/ExtUtils/typemap" SCF.xs &gt; SCF.xsc &amp;&amp; mv SCF.xsc SCF.c<br />Please specify prototyping behavior for SCF.xs (see perlxs manual)<br />x86_64-linux-gnu-gcc -c -D_REENTRANT -D_GNU_SOURCE -DDEBIAN -fwrapv -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -g -DVERSION=\"1.01\" -DXS_VERSION=\"1.01\" -fPIC "-I/usr/lib/x86_64-linux-gnu/perl/5.22/CORE" -DLITTLE_ENDIAN SCF.c<br />In file included from /usr/lib/x86_64-linux-gnu/perl/5.22/CORE/perl.h:5546:0,<br /> from SCF.xs:5:<br />SCF.xs: In function &lsquo;XS_Bio__SCF_get_scf_pointer&rsquo;:<br />SCF.xs:57:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]<br /> ret_val = newSViv((int)scf_data);<br /> ^<br />/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro &lsquo;newSViv&rsquo;<br /> #define newSViv(a) Perl_newSViv(aTHX_ a)<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_get_scf_fpointer&rsquo;:<br />SCF.xs:80:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]<br /> ret_val = newSViv((int)scf_data);<br /> ^<br />/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro &lsquo;newSViv&rsquo;<br /> #define newSViv(a) Perl_newSViv(aTHX_ a)<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_scf_free&rsquo;:<br />SCF.xs:89:17: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> scf_deallocate((Scf *)scf_pointer);<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_get_comments&rsquo;:<br />SCF.xs:95:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_set_comments&rsquo;:<br />SCF.xs:108:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_scf_write&rsquo;:<br />SCF.xs:121:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_scf_fwrite&rsquo;:<br />SCF.xs:137:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_get_from_header&rsquo;:<br />SCF.xs:159:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_get_at&rsquo;:<br />SCF.xs:186:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_set_base_at&rsquo;:<br />SCF.xs:242:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />SCF.xs: In function &lsquo;XS_Bio__SCF_set_at&rsquo;:<br />SCF.xs:255:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]<br /> Scf *scf_data = (Scf *)scf_pointer;<br /> ^<br />rm -f blib/arch/auto/Bio/SCF/SCF.so<br />x86_64-linux-gnu-gcc -shared -L/usr/local/lib -fstack-protector-strong SCF.o -o blib/arch/auto/Bio/SCF/SCF.so \<br /> -lread -lz \<br /> <br />/usr/local/lib/libread.a(open_trace_file.o): In function `find_file_url':<br />open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'<br />chmod 755 blib/arch/auto/Bio/SCF/SCF.so<br />"/usr/bin/perl" -MExtUtils::Command::MM -e 'cp_nonempty' -- SCF.bs blib/arch/auto/Bio/SCF/SCF.bs 644<br />Manifying 1 pod document</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35983/some-useful-bioinformatics-links</guid>
	<pubDate>Fri, 16 Mar 2018 20:50:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35983/some-useful-bioinformatics-links</link>
	<title><![CDATA[Some useful Bioinformatics links]]></title>
	<description><![CDATA[<p><br /> Reference-free prediction of rearrangement breakpoint reads | Bioinformatics | Oxford Academic</p><p>https://academic.oup.com/bioinformatics/article/30/18/2559/2475628<br /> Reference-free SNP detection: dealing with the data deluge</p><p>https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4083407/<br /> GATB/DiscoSnp: DiscoSnp is designed for discovering all kinds of SNPs (not only isolated ones), as well as insertions and deletions, from raw set(s) of reads.</p><p>https://github.com/GATB/DiscoSnp<br /> De novo assembly | Oxford Nanopore Technologies</p><p>https://nanoporetech.com/taxonomy/term/131<br /> De novo long-read assembly of a complex animal genome | bioRxiv</p><p>https://www.biorxiv.org/content/early/2017/09/10/187054<br /> Rapid de novo assembly of the European eel genome from nanopore sequencing reads | Scientific Reports</p><p>https://www.nature.com/articles/s41598-017-07650-6.epdf?author_access_token=dktG7e98wyRJnaEEMTcPqtRgN0jAjWel9jnR3ZoTv0P7E7t-wVGo30iojNO7dICajNY_7PE5xVPv6OoLe7hn9TeUjcZ5umREOzNoPMWkfYH58RS6uxm3vm4e4BG2AA_WKW84i6egKK271NwMq-NfzA%3D%3D<br /> nanoporetech/ont-assembly-polish: ONT assembly and Illumina polishing pipeline</p><p>https://github.com/nanoporetech/ont-assembly-polish<br /> Generade-nl/TULIP: TULIP - The Uncorrected Long read Itegration Pipeline</p><p>https://github.com/Generade-nl/TULIP<br /> www.nature.com</p><p>https://www.nature.com/articles/s41598-017-03996-z<br /> Example gallery of NanoPlot &ndash; Gigabase or gigabyte</p><p>https://gigabaseorgigabyte.wordpress.com/2017/06/01/example-gallery-of-nanoplot/<br /> Tool documentation</p><p>https://broadinstitute.github.io/picard/command-line-overview.html<br /> Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. - PubMed - NCBI</p><p>https://www.ncbi.nlm.nih.gov/pubmed/24185095<br /> MAFFT ver.7 - a multiple sequence alignment program</p><p>https://mafft.cbrc.jp/alignment/software/algorithms/algorithms.html<br /> Measuring the distance between multiple sequence alignments | Bioinformatics | Oxford Academic</p><p>https://academic.oup.com/bioinformatics/article/28/4/495/212883<br /> The MUMmer 3 examples</p><p>http://mummer.sourceforge.net/examples/<br /> MAFFT ver.7 - a multiple sequence alignment program</p><p>https://mafft.cbrc.jp/alignment/software/tips.html<br /> Omega | Overlap-graph de novo Assembler for Metagenomics</p><p>https://omega.omicsbio.org/<br /> abiswas-odu/Disco: Multi-threaded Distributed Memory Overlap-Layout-Consensus (OLC) Metagenome Assembler</p><p>https://github.com/abiswas-odu/Disco<br /> SAGE: String-overlap Assembly of GEnomes | BMC Bioinformatics | Full Text</p><p>https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-15-302</p><p>Fast and sensitive mapping of nanopore sequencing reads with GraphMap | Nature Communications</p><p>https://www.nature.com/articles/ncomms11307<br /> lumpy-sv/extractSplitReads_BwaMem at master &middot; arq5x/lumpy-sv</p><p>https://github.com/arq5x/lumpy-sv/blob/master/scripts/extractSplitReads_BwaMem<br /> jts/nanocorrect: Experimental pipeline for correcting nanopore reads</p><p>https://github.com/jts/nanocorrect</p><p>video - how to install flash plugin on ubuntu 14.04 LTS 64-bit version - Ask Ubuntu</p><p>https://askubuntu.com/questions/469553/how-to-install-flash-plugin-on-ubuntu-14-04-lts-64-bit-version<br /> lh3/fermi: A WGS de novo assembler based on the FMD-index for large genomes</p><p>https://github.com/lh3/fermi<br /> Multi-metagenome</p><p>http://madsalbertsen.github.io/multi-metagenome/docs/step9.html<br /> Bandage by rrwick</p><p>https://rrwick.github.io/Bandage/<br /> Codon Optimization OnLine (COOL): a web-based multi-objective optimization platform for synthetic gene design | Bioinformatics | Oxford Academic</p><p>https://academic.oup.com/bioinformatics/article/30/15/2210/2391162<br /> Genome Architecture and Evolution of a Unichromosomal Asexual Nematode - ScienceDirect</p><p>https://www.sciencedirect.com/science/article/pii/S096098221731076X?via%3Dihub#fig4<br /> How to determine chimeras in my de novo assembly? - SEQanswers</p><p>http://seqanswers.com/forums/showthread.php?t=26721<br /> samtools(1) manual page</p><p>http://www.htslib.org/doc/samtools.html<br /> How To Filter Mapped Reads With Samtools</p><p>https://www.biostars.org/p/56246/<br /> The MUMmer 3 manual</p><p>http://mummer.sourceforge.net/manual/#nucmer<br /> assembly_olc.pdf</p><p>http://www.cs.jhu.edu/~langmea/resources/lecture_notes/assembly_olc.pdf<br /> SAM and BAM filtering oneliners</p><p>https://gist.github.com/davfre/8596159<br /> Inroduction to dot-plots</p><p>http://www.code10.info/index.php%3Foption%3Dcom_content%26view%3Darticle%26id%3D64:inroduction-to-dot-plots%26catid%3D52:cat_coding_algorithms_dot-plots%26Itemid%3D76<br /> RepeatFinder Home Page</p><p>http://www.cbcb.umd.edu/software/RepeatFinder/<br /> RepeatFinderReprint.pdf</p><p>http://www.cbcb.umd.edu/software/RepeatFinder/RepeatFinderReprint.pdf<br /> https://bernatgel.github.io/karyoploter_tutorial//Tutorial/CreateIdeogram/CreateIdeogram.html</p><p>https://bernatgel.github.io/karyoploter_tutorial//Tutorial/CreateIdeogram/CreateIdeogram.html<br /> Circular Visualization in R</p><p>http://zuguang.de/circlize_book/book/introduction.html#a-qiuck-glance<br /> Creating a coverage plot using BEDTools and R</p><p>https://davetang.org/muse/2015/08/05/creating-a-coverage-plot-using-bedtools-and-r/<br /> Eval: A software package for analysis of genome annotations | BMC Bioinformatics | Full Text</p><p>https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-4-50<br /> eval-documentation.pdf</p><p>http://mblab.wustl.edu/media/software/eval-documentation.pdf<br /> OmicCircos: A Simple-to-Use R Package for the Circular Visualization of Multidimensional Omics Data</p><p>https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3921174/<br /> sequence - download.tardigrades.org &gt; v1 &gt; sequence</p><p>http://download.tardigrades.org/v1/sequence/<br /> ksahlin/BESST: BESST - scaffolder for genomic assemblies</p><p>https://github.com/ksahlin/BESST<br /> reubwn/scripts: Useful scripts for various things</p><p>https://github.com/reubwn/scripts<br /> ICEberg</p><p>http://db-mml.sjtu.edu.cn/ICEberg/index.php<br /> Satsuma - Evolution and Genomics</p><p>http://evomics.org/learning/genomics/satsuma/<br /> A complete bacterial genome assembled de novo using only nanopore sequencing data | Nature Methods</p><p>https://www.nature.com/articles/nmeth.3444<br /> vezzi/FRC_align: Computes FRC from SAM/BAM file and not from afg files</p><p>https://mail.google.com/mail/u/0/#inbox<br /> Read GTF file into R - Dave Tang's blog</p><p>https://davetang.org/muse/2017/08/04/read-gtf-file-r/</p><p>https://bernatgel.github.io/karyoploter_tutorial//Tutorial/CustomGenomes/CustomGenomes.html</p><p>https://bernatgel.github.io/karyoploter_tutorial//Tutorial/CustomGenomes/CustomGenomes.html<br /> Dot: Interactive dot plot for genome-genome alignments</p><p>https://dnanexus.github.io/dot/<br /> Zoho Accounts</p><p>https://accounts.zoho.eu/signin?servicename=ZohoProjects&amp;serviceurl=https%3A%2F%2Fprojects.zoho.eu%2Fportal%2Favaga2<br /> lh3/minimap2: A versatile pairwise aligner for genomic and spliced nucleotide sequences</p><p>https://github.com/lh3/minimap2<br /> SSPACE-LongRead: scaffolding bacterial draft genomes using long read sequence information | BMC Bioinformatics | Full Text</p><p>https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-15-211<br /> Palindromic gene amplification &mdash; an evolutionarily conserved role for DNA inverted repeats in the genome | Nature Reviews Cancer</p><p>https://www.nature.com/articles/nrc2591<br /> bioinformatics - BLAST DNA Sequences Reversed - Biology Stack Exchange</p><p>https://biology.stackexchange.com/questions/8160/blast-dna-sequences-reversed<br /> LASTZ</p><p>http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00a.html<br /> SOGo - (1652) Inbox</p><p>https://sogo.unamur.be/SOGo/so/jnarayan/Mail/view<br /> Tetra-Nucleotide Analysis (TNA) | BIOiPLUG Help center</p><p>http://help.bioiplug.com/tetra-nucleotide-analysis-tna/</p><p>Clustering metagenomic contigs on tetranucleotide frequency &mdash; CGAT documentation</p><p>http://cgat.readthedocs.io/en/latest/recipes/metagenome_contigs_kmers.html</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35915/iupac-codes</guid>
	<pubDate>Tue, 13 Mar 2018 05:16:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35915/iupac-codes</link>
	<title><![CDATA[IUPAC codes]]></title>
	<description><![CDATA[<p>IUPAC codes</p><p>DNA:</p><p>Nucleotide Code: Base:</p><p>---------------- -----</p><p>A.................Adenine</p><p>C.................Cytosine</p><p>G.................Guanine</p><p>T (or U)..........Thymine (or Uracil)</p><p>R.................A or G</p><p>Y.................C or T</p><p>S.................G or C</p><p>W.................A or T</p><p>K.................G or T</p><p>M.................A or C</p><p>B.................C or G or T</p><p>D.................A or G or T</p><p>H.................A or C or T</p><p>V.................A or C or G</p><p>N.................any base . or -............gap</p><p>Protein:</p><p>Amino Acid Code: Three letter Code: Amino Acid:</p><p>---------------- ------------------ -----------</p><p>A.................Ala.................Alanine</p><p>B.................Asx.................Aspartic acid or Asparagine</p><p>C.................Cys.................Cysteine</p><p>D.................Asp.................Aspartic Acid</p><p>E.................Glu.................Glutamic Acid</p><p>F.................Phe.................Phenylalanine</p><p>G.................Gly.................Glycine</p><p>H.................His.................Histidine</p><p>I.................Ile.................Isoleucine</p><p>K.................Lys.................Lysine</p><p>L.................Leu.................Leucine</p><p>M.................Met.................Methionine</p><p>N.................Asn.................Asparagine</p><p>P.................Pro.................Proline</p><p>Q.................Gln.................Glutamine</p><p>R.................Arg.................Arginine</p><p>S.................Ser.................Serine</p><p>T.................Thr.................Threonine</p><p>V.................Val.................Valine</p><p>W.................Trp.................Tryptophan</p><p>X.................Xaa.................Any amino acid</p><p>Y.................Tyr.................Tyrosine</p><p>Z.................Glx.................Glutamine or Glutamic acid</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist</guid>
	<pubDate>Fri, 02 Mar 2018 06:54:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist</link>
	<title><![CDATA[Python learning resources for bioinformatics and computational biologist !]]></title>
	<description><![CDATA[<p>Python is a general-purpose language, which means it can be used to build just about anything, which will be made easy with the right tools/libraries.</p><p>Professionally, Python is great for backend web development, data analysis, artificial intelligence, and scientific computing. Many developers have also used Python to build productivity tools, games, and desktop apps, so there are plenty of resources to help you learn how to do those as well.</p><p>For pros and cons visit&nbsp;http://www.bestprogramminglanguagefor.me/why-learn-python and&nbsp;http://bioinformaticsonline.com/discussion/view/459/python-vs-perl</p><p>More resources at&nbsp;https://github.com/CodementorIO/Python-Learning-Resources</p><p>Following are the list of useful python programming resources:</p><ul>
<li><a href="http://www.oreilly.com/programming/free/20-python-libraries-you-arent-using-but-should.csp">20 Python Libraries You Aren't Using (But Should)</a>&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="https://en.wikibooks.org/wiki/A_Beginner%27s_Python_Tutorial">A Beginner's Python Tutorial</a></li>
<li><a href="https://python.swaroopch.com/">A Byte of Python</a>&nbsp;(3.x) (HTML, PDF, EPUB, Mobi)</li>
<li><a href="https://github.com/RafeKettler/magicmethods">A Guide to Python's Magic Methods</a>&nbsp;- Rafe Kettler</li>
<li><a href="http://www.oreilly.com/programming/free/files/a-whirlwind-tour-of-python.pdf">A Whirlwind Tour of Python</a>&nbsp;- Jake VanderPlas (PDF)&nbsp;<a href="http://www.oreilly.com/programming/free/a-whirlwind-tour-of-python.csp?download=yes">(EPUB, MOBI)</a></li>
<li><a href="http://automatetheboringstuff.com/chapter0/">Automate the Boring Stuff</a>&nbsp;- Al Sweigart</li>
<li><a href="http://biopython.org/DIST/docs/tutorial/Tutorial.pdf">Biopython</a>&nbsp;(PDF)</li>
<li><a href="http://github.com/thewhitetulip/build-app-with-python-antitextbook">Build applications in Python the antitextbook</a>&nbsp;(3.x) (HTML, PDF, EPUB, Mobi)</li>
<li><a href="https://www.packtpub.com/packt/free-ebook/python-machine-learning-algorithms">Building Machine Learning Systems with Python</a>&nbsp;- Willi Richert &amp; Luis Pedro Coelho, Packt.&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://www.itmaybeahack.com/book/oodesign-python-2.1/latex/BuildingSkillsinOODesign.pdf">Building Skills in Object-Oriented Design (Python)</a>&nbsp;(PDF) (2.1.1)</li>
<li><a href="http://www.itmaybeahack.com/book/python-2.6/latex/BuildingSkillsinPython.pdf">Building Skills in Python</a>&nbsp;(PDF) (2.6)</li>
<li><a href="http://python.net/~goodger/projects/pycon/2007/idiomatic/handout.html">Code Like a Pythonista: Idiomatic Python</a></li>
<li><a href="https://www.codecademy.com/learn/python">CodeCademy Python</a></li>
<li><a href="http://composingprograms.com/">Composing Programs</a>&nbsp;(3.x)</li>
<li><a href="https://web.archive.org/web/20161016153130/http://www.brpreiss.com/books/opus7/html/book.html">Data Structures and Algorithms in Python</a>&nbsp;- B. R. Preiss (PDF)</li>
<li><a href="http://getpython3.com/diveintopython3/">Dive into Python 3</a>&nbsp;- Mark Pilgrim (3.0)
<ul>
<li><a href="http://www.diveintopython.net/">Dive into Python</a>&nbsp;- Mark Pilgrim (2.3)</li>
</ul>
</li>
<li><a href="http://www.labri.fr/perso/nrougier/from-python-to-numpy/">From Python to NumPy</a></li>
<li><a href="http://www.fullstackpython.com/">Full Stack Python</a></li>
<li><a href="http://www.oreilly.com/programming/free/functional-programming-python.csp">Functional Programming in Python</a>&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://python.cs.southern.edu/pythonbook/pythonbook.pdf">Fundamentals of Python Programming</a>&nbsp;- Richard L. Halterman (PDF) (3.2)</li>
<li><a href="https://developers.google.com/edu/python/">Google's Python Class</a>&nbsp;(2.4 - 2.x)</li>
<li><a href="https://google.github.io/styleguide/pyguide.html">Google's Python Style Guide</a></li>
<li><a href="http://inventwithpython.com/hacking/chapters/">Hacking Secret Cyphers with Python</a>&nbsp;- Al Sweigart (3.3)</li>
<li><a href="http://www.oreilly.com/programming/free/hadoop-with-python.csp">Hadoop with Python</a>&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://ianozsvald.com/HighPerformancePythonfromTrainingatEuroPython2011_v0.2.pdf">High Performance Python</a>&nbsp;(PDF)</li>
<li><a href="http://docs.python-guide.org/en/latest/">Hitchhiker's Guide to Python!</a>&nbsp;(2.6)</li>
<li><a href="http://www.oreilly.com/programming/free/files/how-to-make-mistakes-in-python.pdf">How to Make Mistakes in Python</a>&nbsp;- Mike Pirnat (PDF) (1st edition)</li>
<li><a href="http://interactivepython.org/courselib/static/thinkcspy/index.html">How to Think Like a Computer Scientist: Learning with Python, Interactive Edition</a>&nbsp;(3.2)
<ul>
<li><a href="http://www.greenteapress.com/thinkpython/thinkCSpy/">How to Think Like a Computer Scientist: Learning with Python</a>&nbsp;- Allen B. Downey, Jeff Elkner and Chris Meyers (2.4)</li>
<li><a href="http://www.greenteapress.com/thinkpython/">Think Python</a>&nbsp;- Allen B. Downey (2.x &amp; 3.0)</li>
</ul>
</li>
<li><a href="http://book.pythontips.com/en/latest/index.html">Intermediate Python</a>&nbsp;- Muhammad Yasoob Ullah Khalid (1st edition)</li>
<li><a href="http://opentechschool.github.io/python-beginners/en/">Introduction to Programming with Python</a>&nbsp;(3.3)
<ul>
<li><a href="http://python-ebook.blogspot.co.uk/">Introduction to Programming Using Python</a>&nbsp;- Cody Jackson (1st edition) (2.3)</li>
</ul>
</li>
<li><a href="http://kracekumar.com/post/71171551647/introduction-to-python">Introduction to Python</a>&nbsp;- Kracekumar (2.7.3)</li>
<li><a href="http://inventwithpython.com/chapters/">Invent Your Own Computer Games With Python</a>&nbsp;- Al Sweigart (3.1)</li>
<li><a href="http://learnpythonbreakpython.com/">Learn Python, Break Python</a></li>
<li><a href="https://learnxinyminutes.com/docs/python/">Learn Python in Y minutes</a></li>
<li><a href="http://learnpythonthehardway.org/book/">Learn Python The Hard Way</a>&nbsp;(2.5 - 2.6)</li>
<li><a href="https://www.ida.liu.se/~732A47/literature/PythonBook.pdf">Learn to Program Using Python</a>&nbsp;- Cody Jackson (PDF)</li>
<li><a href="https://www.packtpub.com/packt/free-ebook/learning-python">Learning Python</a>&nbsp;- Fabrizio Romano, Packt.&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://www.alan-g.me.uk/">Learning to Program</a></li>
<li><a href="https://github.com/jrjohansson/scientific-python-lectures">Lectures on scientific computing with python</a>&nbsp;- J.R. Johansson (2.7)</li>
<li><a href="http://inventwithpython.com/pygame/chapters/">Making Games with Python &amp; Pygame</a>&nbsp;- Al Sweigart (2.7)</li>
<li><a href="http://www.clips.ua.ac.be/sites/default/files/modeling-creativity.pdf">Modeling Creativity: Case Studies in Python</a>&nbsp;- Tom D. De Smedt (PDF)</li>
<li><a href="http://www.nltk.org/book/">Natural Language Processing with Python</a>&nbsp;(3.x)</li>
<li><a href="https://en.wikibooks.org/wiki/Non-Programmer%27s_Tutorial_for_Python_3">Non-Programmer's Tutorial for Python 3</a>&nbsp;(3.3)
<ul>
<li><a href="https://en.wikibooks.org/wiki/Non-Programmer%27s_Tutorial_for_Python_2.6">Non-Programmer's Tutorial for Python 2.6</a>&nbsp;(2.6)</li>
</ul>
</li>
<li><a href="http://www.oreilly.com/programming/free/from-future-import-python.csp">Picking a Python Version: A Manifesto</a>&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://python3porting.com/">Porting to Python 3: An In-Depth Guide</a>&nbsp;(2.6 - 2.x &amp; 3.1 - 3.x)</li>
<li><a href="https://launchpadlibrarian.net/165489933/PracticalProgrammingPython2014.pdf">Practical Programming in Python</a>&nbsp;- Jeffrey Elkner (PDF)</li>
<li><a href="http://interactivepython.org/runestone/static/pythonds/index.html">Problem Solving with Algorithms and Data Structures using Python</a>&nbsp;- Bradley N. Miller and David L. Ranum</li>
<li><a href="http://programarcadegames.com/">Program Arcade Games With Python And Pygame</a>&nbsp;(3.3)</li>
<li><a href="http://programmingcomputervision.com/downloads/ProgrammingComputerVision_CCdraft.pdf">Programming Computer Vision with Python</a>&nbsp;(PDF)</li>
<li><a href="https://docs.python.org/2/download.html">Python 2 Official Documentation</a>&nbsp;(PDF, HTML, TEXT) (2.x)</li>
<li><a href="http://infohost.nmt.edu/tcc/help/pubs/python/web/">Python 2.7 quick reference</a>&nbsp;- New Mexico Tech (2.7)</li>
<li><a href="https://docs.python.org/3/download.html">Python 3 Official Documentation</a>&nbsp;(PDF, EPUB, HTML, TEXT) (3.x)</li>
<li><a href="http://chimera.labs.oreilly.com/books/1230000000393/index.html">Python Cookbook</a>&nbsp;- David Beazley</li>
<li><a href="https://github.com/jakevdp/PythonDataScienceHandbook">Python Data Science Handbook</a>&nbsp;- Jake VanderPlas (HTML, Jupyter Notebooks)</li>
<li><a href="http://www.kevinsheppard.com/images/0/09/Python_introduction.pdf">Python for Econometrics</a>&nbsp;- Kevin Sheppard (PDF) (2.7.5)</li>
<li><a href="http://py4e.com/book.php">Python for Everybody Exploring Data Using Python 3</a>&nbsp;- Charles Severance (PDF, EPUB, HTML)
<ul>
<li><a href="http://www.pythonlearn.com/book.php">Python for Informatics: Exploring Information</a>&nbsp;(2.7.5)</li>
</ul>
</li>
<li><a href="http://pymbook.readthedocs.org/en/latest/">Python for you and me</a>&nbsp;(2.7.3)</li>
<li><a href="http://pymbook.readthedocs.org/en/py3/">Python for you and me</a>&nbsp;(3.x)</li>
<li><a href="http://safehammad.com/downloads/python-idioms-2014-01-16.pdf">Python Idioms</a>&nbsp;(PDF)</li>
<li><a href="http://www.oreilly.com/programming/free/python-in-education.csp">Python in Education</a>&nbsp;<em>(Just fill the fields with any values)</em></li>
<li><a href="http://www.greenteapress.com/pythonhydro/pythonhydro.html">Python in Hydrology</a>&nbsp;- Sat Kumar Tomer</li>
<li><a href="https://github.com/gregmalcolm/python_koans">Python Koans</a>&nbsp;(2.7 or 3.x)</li>
<li><a href="https://pymotw.com/3/">Python Module of the Week</a>&nbsp;(3.x)
<ul>
<li><a href="https://pymotw.com/2/">Python Module of the Week</a>&nbsp;(2.x)</li>
</ul>
</li>
<li><a href="http://books.goalkicker.com/PythonBook/">Python Notes for Professionals</a>&nbsp;- Compiled from StackOverflow documentation (3.x)</li>
<li><a href="http://anandology.com/python-practice-book/index.html">Python Practice Book</a>&nbsp;(2.7.1)</li>
<li><a href="http://pythonpracticeprojects.com/">Python Practice Projects</a></li>
<li><a href="https://upload.wikimedia.org/wikipedia/commons/9/91/Python_Programming.pdf">Python Programming</a>&nbsp;(PDF) (2.6)</li>
<li><a href="http://scipy-lectures.github.io/">Scipy Lecture Notes</a></li>
<li><a href="http://www-inst.eecs.berkeley.edu/~cs61a/sp12/book/">SICP in Python</a>&nbsp;(3.2)</li>
<li><a href="http://www.briggs.net.nz/snake-wrangling-for-kids.html">Snake Wrangling For Kids</a>&nbsp;(3.x)</li>
<li><a href="http://python3porting.com/">Suporting Python 3: An In-Depth Guide</a>&nbsp;(2.6 - 2.x &amp; 3.1 - 3.x)</li>
<li><a href="http://chimera.labs.oreilly.com/books/1234000000754/index.html">Test-Driven Web Development with Python</a>&nbsp;(3.3 - 3.x)</li>
<li><a href="http://gnosis.cx/TPiP/">Text Processing in Python</a>&nbsp;- David Mertz (2.3 - 2.x)</li>
<li><a href="http://www.spronck.net/pythonbook/">The Coder's Apprentice: Learning Programming with Python 3</a>&nbsp;- Pieter Spronck (PDF) (3.x)</li>
<li><a href="http://www.jython.org/jythonbook/en/1.0">The Definitive Guide to Jython, Python for the Java Platform</a>&nbsp;- Josh Juneau, Jim Baker, Victor Ng, Leo Soto, Frank Wierzbicki (2.5)</li>
<li><a href="http://docs.quantifiedcode.com/python-anti-patterns/">The Little Book of Python Anti-Patterns</a>&nbsp;(<a href="https://github.com/quantifiedcode/python-anti-patterns">Source</a>)</li>
<li><a href="http://niche-canada.org/research/niche-digital-infrastructure-project/the-programming-historian/">The Programming Historian</a>&nbsp;- William J. Turkel, Adam Crymble and Alan MacEachern</li>
<li><a href="http://mirnazim.org/writings/python-ecosystem-introduction/">The Python Ecosystem: An Introduction</a></li>
<li><a href="http://python-gtk-3-tutorial.readthedocs.org/en/latest/">The Python GTK+ 3 Tutorial</a></li>
<li><a href="http://effbot.org/librarybook/">The Standard Python Library</a>&nbsp;- Fredrik Lundh</li>
<li><a href="http://greenteapress.com/complexity/">Think Complexity</a>&nbsp;- Allen B. Downey (2nd Edition) (PDF, HTML)</li>
<li><a href="http://web2py.com/book">Web2py: Complete Reference Manual, 6th Edition (pre-release)</a>&nbsp;(2.5 - 2.x)</li>
<li><a href="https://en.wikibooks.org/wiki/Python_Programming">Wikibooks: Python Programming</a>&nbsp;(2.7)</li>
</ul>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35802/bioinformatics-tools-to-detect-horizontal-gene-transfer-hgt-in-genomes</guid>
	<pubDate>Fri, 02 Mar 2018 04:56:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35802/bioinformatics-tools-to-detect-horizontal-gene-transfer-hgt-in-genomes</link>
	<title><![CDATA[Bioinformatics tools to detect horizontal gene transfer (HGT) in genomes]]></title>
	<description><![CDATA[<p>Horizontal gene transfer (HGT), the &ldquo;non-sexual movement of genetic material between two organisms&rdquo; , is relatively common in prokaryotes&nbsp;and single-celled eukaryotes, but a number of factors combine to make it far rarer in multicellular eukaryotes. In order for a eukaryotic species to gain a gene by HGT, foreign DNA must enter the host nucleus, integrate into the genome, and in more complex organisms it must enter the sequestered germline in order to be transmitted to offspring. Once there, it must not experience strong negative selection, despite potential for genetic incompatibility with the host genome and mismatch between the niche of the donor and the host. Over the longer term, foreign DNA may become &ldquo;domesticated&rdquo; in the recipient genome and provide novel function.</p><p>Following are the popular tool to detect HGT in genomes:</p><p><a href="http://www.trex.uqam.ca/index.php?action=hgt&amp;project=trex">T-REX</a>&nbsp;/&nbsp;<a href="http://www.trex.uqam.ca/download/hgt-detection_3.22.zip">3.22</a></p><p>HGT detection /&nbsp;download &amp; compile</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/20525630">20525630</a></p><p>&nbsp;</p><p><a href="http://compbio.engr.uconn.edu/software/RANGER-DTL/">RANGER-DTL</a>&nbsp;/&nbsp;<a href="http://compbio.engr.uconn.edu/software/RANGER-DTL/Linux.zip">2.0</a></p><p>HGT detection /&nbsp;download binary</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/22689773">22689773</a></p><p>&nbsp;</p><p><a href="https://bioinfocs.rice.edu/phylonet">PhyloNet</a>&nbsp;/&nbsp;<a href="https://bioinfocs.rice.edu/sites/g/files/bxs266/f/kcfinder/files/PhyloNet_3.6.1.jar">3.6.1</a></p><p>HGT detection /&nbsp;download binary</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/18662388">18662388</a></p><p>&nbsp;</p><p><a href="https://www.cs.hmc.edu/~hadas/jane/index.html">Jane</a>&nbsp;/&nbsp;<a href="https://www.cs.hmc.edu/~hadas/jane/form.html">4.01</a></p><p>HGT detection /&nbsp;download binary (!license!)</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/20181081">20181081</a></p><p>&nbsp;</p><p><a href="http://www.tree-puzzle.de/">TREE-PUZZLE</a>&nbsp;/&nbsp;<a href="http://www.tree-puzzle.de/tree-puzzle-5.3.rc16-linux.tar.gz">5.3.rc16</a></p><p>HGT detection /&nbsp;download &amp; compile</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/11934758">11934758</a></p><p>&nbsp;</p><p><a href="http://www.sigmath.es.osaka-u.ac.jp/shimo-lab/prog/consel/">CONSEL</a>&nbsp;/&nbsp;<a href="http://www.sigmath.es.osaka-u.ac.jp/shimo-lab/prog/consel/pub/cnsls020.tgz">0.20</a></p><p>HGT detection /&nbsp;download</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/11751242">11751242</a></p><p>&nbsp;</p><p><a href="http://darkhorse.ucsd.edu/">DarkHorse</a>&nbsp;/&nbsp;<a href="http://darkhorse.ucsd.edu/DarkHorse-1.5_rev170.tar.gz">1.5 rev170</a></p><p>HGT detection /&nbsp;download &amp; install</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/17274820">17274820</a></p><p>&nbsp;</p><p><a href="https://github.com/DittmarLab/HGTector">HGTector</a>&nbsp;/&nbsp;<a href="https://github.com/DittmarLab/HGTector/archive/wgshgt.zip">0.2.1</a></p><p>HGT detection /&nbsp;git clone</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/25159222">25159222</a></p><p>&nbsp;</p><p><a href="http://www5.esu.edu/cpsc/bioinfo/software/EGID/">EGID</a>&nbsp;/&nbsp;<a href="http://www5.esu.edu/cpsc/bioinfo/software/EGID/EGID_1.0.tar.gz">1.0</a></p><p>HGT detection /&nbsp;download</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/22355228">22355228</a></p><p>&nbsp;</p><p><a href="http://exon.gatech.edu/GeneMark/">GeneMarkS</a>&nbsp;/&nbsp;<a href="http://exon.gatech.edu/GeneMark/license_download.cgi">4.30</a></p><p>HGT detection / download binary (!license!)</p><p><a href="https://www.ncbi.nlm.nih.gov/pubmed/9461475">9461475</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35747/webinar-on-rna-seq-data-analysis-on-28-feb-2018</guid>
	<pubDate>Thu, 22 Feb 2018 06:38:48 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35747/webinar-on-rna-seq-data-analysis-on-28-feb-2018</link>
	<title><![CDATA[Webinar on RNA-Seq Data Analysis on 28 Feb 2018]]></title>
	<description><![CDATA[<p>Strand NGS is a biologist friendly NGS analysis tool that allows biologists to analyze their data using a very intuitive workflow for the analysis and visualization of RNA-Seq data. This webinar will give an overview of the workflow which includes Transcriptome/ Genome alignment, Differential expression analysis, Splicing events and gene fusion detection. Strand NGS also supports novel discovery like identification of novel genes, exons and novel splice junctions.<br />We will highlight the use of Strand NGS features such as PCA, sample correlation, clustering, Venn diagrams, CVA, UMI support and elastic genome browser used in RNA-Seq workflow that supports large scale RNA-Seq data analysis too. The tool also supports biological contextualization on the set of interesting genes from the data by allowing downstream analysis such as GO and pathway analysis. The product has an option to create pipelines for time consuming jobs which automates analysis and leaves more time for end data interpretation. This webinar will give an overview of the features in the RNA-Seq data analysis workflow in Strand NGS.</p><p>Details:<br /><a href="http://www.strand-ngs.com/webinar_registration">Session 1: </a>28 Feb 2018, 9 AM CET<br /><a href="http://www.strand-ngs.com/webinar_registration">Session 2:</a> 28 Feb 2018, 8 AM PST<br />Register here: http://www.strand-ngs.com/webinar_registration</p><p><span style="font-size: 12.8px;">About Speaker:</span></p><p>Dr. Suman Kapoor, Manager- Application Science at Strand Life Sciences, has over 11 years experience in molecular biology, next-generation sequencing based testing, clinical genomics, and personalized medicine for disease management and prenatal testing. Dr. Suman holds a Ph.D in Molecular and Cell Biology from Indian Institute of Science, Bangalore. Prior to joining Strand NGS team, Suman has worked extensively on protein synthesis in eubacteria and has experience working in CAP and NABL accredited lab validating and interpreting NGS based diagnostic tests.</p>]]></description>
	<dc:creator>Strand</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35559/computational-resources-for-te-discovery-and-te-detection</guid>
	<pubDate>Mon, 12 Feb 2018 10:29:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35559/computational-resources-for-te-discovery-and-te-detection</link>
	<title><![CDATA[Computational resources for TE discovery and TE detection]]></title>
	<description><![CDATA[<p><span>Transposable Elements (TEs) to genome structure and evolution as well as their impact on genome sequencing, assembly, annotation and alignment has generated increasing interest in developing new methods for their computational analysis. </span></p><p><span>Following are the list of r</span><span>esource and location for TE discovery and TE detection:</span></p><p>BLASTER suite&nbsp;http://urgi.versailles.inra.fr/development/blaster/&nbsp;</p><p>Censor&nbsp;http://www.girinst.org/censor/download.php&nbsp;</p><p>find_ltr&nbsp;http://darwin.informatics.indiana.edu/cgi-bin/evolution/ltr.pl&nbsp;</p><p>FINDMITE http://jaketu.biochem.vt.edu/dl_software.htm </p><p>HMMER http://hmmer.janelia.org/ </p><p>LTR_FINDER http://tlife.fudan.edu.cn/ltr_finder/ </p><p>LTR_STRUC http://www.genetics.uga.edu/retrolab/data/LTR_Struc.html </p><p>LTR_MINER http://genomebiology.com/2004/5/10/R79/suppl/s7 </p><p>LTR_par http://www.eecs.wsu.edu/~ananth/software.htm </p><p>MAK http://wesslercluster.plantbio.uga.edu/mak06.html </p><p>MaskerAid http://blast.wustl.edu/maskeraid/ </p><p>mer-engine http://mer-engine.cshl.edu/mer-home.php </p><p>mreps http://bioinfo.lifl.fr/mreps/ </p><p>PILER http://www.drive5.com/piler/ </p><p>PLOTREP http://repeats.abc.hu/cgi-bin/plotrep.pl </p><p>RepBase http://www.girinst.org/ </p><p>RepeatFinder http://cbcb.umd.edu/software/RepeatFinder/ </p><p>RepeatGluer http://nbcr.sdsc.edu/euler/intro_tmp.htm </p><p>RepeatMasker http://www.repeatmasker.org/ </p><p>RepeatRunner http://www.yandell-lab.org/repeat_runner/index.html </p><p>RepeatScout http://repeatscout.bioprojects.org/ </p><p>repeat-match http://mummer.sourceforge.net/ </p><p>REPuter http://www.genomes.de/ </p><p>RetroMap http://www.burchsite.com/bioi/RetroMapHome.html </p><p>SMaRTFinder http://bioinf.dimi.uniud.it/software/software/smartfinder </p><p>Tandem Repeats Finder http://tandem.bu.edu/trf/trf.html </p><p>Transposon Cluster Finder http://www.mssm.edu/labs/warbup01/paper/files.html </p><p>TE nest http://www.plantgdb.org/prj/TE_nest/TE_nest.html </p><p>TRANSPO http://alggen.lsi.upc.es/recerca/search/transpo/transpo.html </p><p>TSDfinder http://www.ncbi.nlm.nih.gov/CBBresearch/Landsman/TSDfinder/ </p><p>Tu Lab TE tools http://jaketu.biochem.vt.edu/dl_software.htm </p><p>WU-BLAST http://blast.wustl.edu</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>