This is a fixed term post for 36 months.

We wish to recruit a highly motivated, postdoctoral scientist to carry out a BBSRC funded project in the laboratory of Dr. Denis Larkin. The project is focused on developing and applying new algorithms to study genome and chromosome evolution in birds, mammals and other vertebrate species using whole-genome sequences and existing algorithms. The post holder will use cutting edge computational and laboratory approaches to generate chromosomal assemblies for sequenced genomes, study chromosomal structures and genome differences between bird and other vertebrate species in attempt to identify species- and clade-specific genome signatures.

Applicants must have a Ph.D. and a track record of success, as indicated by first-author publications in international journals. They must possess excellent organisation skills and be capable of individual initiative and of interacting as part of a team. Applicants with extensive practical experience in bioinformatics or computer science, programming, visualization, handling of large data sets, high-performance computing are encouraged to apply. The post will involve collaboration with a wide range of academic partners both within the UK, EU and worldwide. In addition to leading their own project the post holder will have opportunities to contribute to multiple international genome initiatives.

Experience in programming, bioinformatics and comparative genome analysis is essential. Applicants should have a minimum of a degree and preferably a higher degree in a relevant subject.

The Royal Veterinary College has the largest range of veterinary, para-veterinary and animal science undergraduate and postgraduate courses of any veterinary school in the world and is one of the largest veterinary schools in Europe.

Prospective applicants are encouraged to contact Dr. Denis Larkin, Comparative Biomedical Sciences Department on +442071211906 or email: dlarkin@rvc.ac.uk

We offer a generous reward package.

For further information and to apply on-line please visit our website: www.rvc.ac.uk
Job reference CBS-0025-14A

Closing date: 4 July 2014
Interviews are likely to be held in July 2014

We promote equality of opportunity and diversity within the workplace and welcome applications from all sections of the community.

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

An Autonomous National Institute under Government of India,
Ministry of Science & Technology
Department of Biotechnology

No: RGCB/ Advt./2014/1
January 24, 2014

Scientist Positions

Group Leader in Computational Biology/Bioinformatics
A highly motivated and innovative individual who will pursue basic research, solve biological problems with emphasis on computational and quantitative experimental methods and build active bridges to translational research. The scientist will also provide computational biology support to analyze complex data sets generated by RGCB scientists and collaborators.

Location: Thiruvananthapuram (Trivandrum)

The above positions will be at the E-II, F or equivalent levels. For senior applicants with an outstanding track record, an option of a contract career path for research excellence at Scientist G or H equivalent level can also be discussed. All positions will initially be for 5 years. Essential and desired qualifications as well as other relevant details for all the above positions are posted on the RGCB website (http://www.rgcb.res.in). The last date for receiving applications is March 14, 2014.

Sd/-
Director

Rajiv Gandhi Centre for Biotechnology
Thycaud, P.O., Poojappura,
Thiruvananthapuram, Kerala, India-695 014
Ph.: 91-471-2529400 (30 Lines), 2347975, 2348104, 2348753, 2345899
Fax: 91-471-2348096, 2346333

More at http://rgcb.res.in/jobs.html

The C-DAC will launch Param Bio Blaze, a supercomputing facility, to address the challenges in bioinformatics on Tuesday at a three-day symposium, titled: 'Accelerating biology: Computing life'. The supercomputing facility will be inaugurated on Tuesday by Ramakrishna Ramaswamy, vice-chancellor, Central University of Hyderabad at the Yashada. The new C-DAC's facility will have a capacity of 10 teraflop and will be able to analyse human cells and its functions.

Param Bio Blaze will help have a larger storage space and better computing facility for the bioinformatics sector. The facility will help capture the movement of molecules and also interaction between two molecules and the effects.

Applications of Param BioBlaze

- Collaboration with National Centre for Cell Science for research on Malaria and understanding how the disease spreads

- Collaborative work with Tata Memorial hospital on breast cancer and find out the difference between normal tissues and tissues from breast cancer patients

- Designing anti-cancer molecules, a collaborative research with the University of Pune

Reference:

Times of India

Image:datacenterjournal.com

However, the ancient invasions and migrations to slavery and trade, history is embroidered with events that led to interactions between previously separate populations. Early humans migrated due to many factors such as changing climate and landscape and inadequate food supply. Historical migration of human populations begins with the movement of Homo erectus out of Africa across Eurasia about a million years ago. Homo sapiens appear to have occupied all of Africa about 150,000 years ago, moved out of Africa 70,000 years ago, and had spread across Australia, Asia and Europe by 40,000 years BC. Indo-Aryan migration from the Indus Valley to the plain of the River Ganges in Northern India is presumed to have taken place in the Middle to Late Bronze Age, contemporary to the Late Harappan phase in India (ca. 1700 to 1300 BC). From 180 BC, a series of invasions from Central Asia followed, including those led by the Indo-Greeks, Indo-Scythians, Indo-Parthians and Kushans in the northwestern Indian subcontinent.

Using the recent advance technologies researchers have created a historical atlas of instances of such mixing. They use a sophisticated statistical method for making inferences about human history and infer populations interbredings ( happen over the past 4,000 years) with an ease.

The study published the findings and presented with an interactive map. http://admixturemap.paintmychromosomes.com/

These sort of genomic study have some limilation. It is hard to precisely define sources of mixing when it occurred between genetically similar groups, and scenarios involving multiple waves of mixing over time or between multiple groups can be difficult to tease apart. But it is believed that larger sample sizes will improve resolution. These high resolution will provide a deeper understanding of human history.

Reference:

http://www.sciencemag.org/content/early/2014/01/28/science.1245938

http://www.ncbi.nlm.nih.gov/pubmed/21390129?dopt=Abstract&holding=npg

http://www.csulb.edu/~kmacd/paper-ethnicity.html

Image: Wikipedia

Candidate Requirements: A PhD in computer science, computational biology, Bioinformatics, or a related field, along with sufficient programming skills for prototyping. Experience with next generation sequencing data analysis is required. Candidates with MS degree but with relevant work experience can also be considered. The successful candidate must be motivated and capable of working independently as well as in team environment.

Eligible and interested candidates can email your resumes to rohit at strandls dot com

About Strand Life Sciences: Strand was founded in 2000 by computer science and mathematics professors who recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand’s solutions for life sciences research are robust and easy to use by the most novice user while powerful and configurable for the bioinformatician. Using its award-winning application development platform, AVADIS®, Strand builds innovative products that enable fast and cutting-edge analysis for basic and clinical research, drug discovery and development.

http://www.avadis-ngs.com/careers

Current computational interests:

Systematic analysis of genetic epistasis to identify redundant or compensatory systems and to reveal order of action in genetic pathways.
Using knockout, knockdown, or overexpression, or other perturbation experiments in combinations of genes in S. cerevisiae, C. elegans or mouse.
Using genome-scale genotyping of natural polymorphisms in S. cerevisiae and human populations.
Alternative splicing and its relationship to protein interaction networks.
Integrating large-scale studies including phenotype, genetic epistasis, protein-protein and transcription-regulatory interactions and sequence patterns to quantitatively assign function to genes and guide experimentation.

More at http://llama.mshri.on.ca/index.html

1) Statistical machine learning methods for the analysis of medical
epigenomics data.

2) Sequence analysis algorithms for detection of RNA-DNA interactions.

Applicants should hold a M.Sc . or PhD in Computer Science or related
areas. Experience in the analysis of biological sequences, gene
expression and gene regulation is desirable. The candidate should have
solid programming skills (C, Python and/or R) and acquaintance with
Linux. Experience with high performance computing is a plus. The
working language of the group is English.

The position is based on the German TV-L 13 salary scale, including
all German social benefits (health insurance and pension scheme). The
expected starting date is September 2014. Interested candidates should
send a CV, statement of research interests and the names of three
references to jobs@costalab.org.

More at http://costalab.org/wp/phd-and-postdoc-position-in-computational-biology/

Registration of active participants will be open from February, 27 12 PM CET to April 17, 23:59 CET. In registration forms you will be asked for providing us with some basic information about yourself. You will also be able to submit your abstract. You can save your registration form after filling it partially and come back later to supply more data e.g. upload an abstract. Your registration will be completed only with the payment of the registration fee reaching our accounts - please make sure to transfer the money in advance!

Registration of passive participants will be open after closing of registration of active participants.

Details an registration: https://ngschool.eu/conference/

2. In some perl script I found this
 . . . . . .
 . . . . . .
# It works for me, only God understood how it is working
while (/(<\/[^>]+>)|(<[^>]+>)|(<[^>]+>)$|([^><]+)/go) {
            $startGene=$1;
            $beginChromosome=$2;
    
. . . . . .
 .. . . . . .
}

3. One more interesting message in Perl found …. It will must tickle you bone :)
open(my $fh, "<", "gene.txt")    or kill " Me if you think this is a mistake :$!";

4. From the Perl

  while () {  # "The Mothership Connection is here!"
    print “$_\n”; # Printing the offspring :)

5. Perl message
if ($1) { print “Just found a the error in chromosome !!!, yahoo…”; else { “That is not error, but mutation you moron!”;

6. One genome database curator walk in wine bar asked the bartender:
CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;