<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/11181?offset=670</link>
	<atom:link href="https://bioinformaticsonline.com/related/11181?offset=670" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10460/assistant-professor-at-jawaharlal-nehru-university-in-delhi</guid>
  <pubDate>Wed, 07 May 2014 00:29:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor at Jawaharlal Nehru University in Delhi]]></title>
  <description><![CDATA[
<p>Advt. No. RC/48/2014</p>

<p>SCHOOL OF COMPUTATIONAL AND INTEGRATIVE SCIENCES (SC&amp;IS)</p>

<p>ESSENTIAL QUALIFICATION : - M.Sc./M.Tech. in Physics/ Chemistry/ Biology/ Mathematics/ Statistics/ Bioinformatics/ Computational Biology. Ph.D. in the broad areas of Bioinformatics/ Computational Biology. Candidates must have demonstrated capabilities in terms of high impact research publications in either of the above mentioned areas.</p>

<p>Scale of Pay : - 15600-39100/- (PB-III) AGP Rs. 6000/-</p>

<p>For more details on Centre/School, Specializations etc. please visit JNU website www.jnu.ac.in or contact Section Officer, Room Nos. 131-132, Recruitment Cell, Administrative Block, JNU, New Delhi – 110067, Email: recruitmentjnu2013@gmail.com The last date for the receipt of application is 15 May, 2014.</p>

<p>http://www.jnu.ac.in/Career/</p>

<p>http://www.jnu.ac.in/Career/ADVTNo_RC_48_2014.pdf<br />Last Apply Date:</p>

<p>15 May 2014</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10773/bioinformatics-jrfsrf-position-at-national-research-centre-on-plant-biotechnology</guid>
  <pubDate>Sun, 11 May 2014 22:29:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics JRF/SRF position at NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY]]></title>
  <description><![CDATA[
<p>NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY<br />LBS, CENTRE, PUSA CAMPUS, IARI NEW DELHI<br />NEW DELHI – 110 012</p>

<p>WALK- IN –INTERVIEWS</p>

<p>Eligible candidates may appear in Walk-in-Interview on May 23, 2014 at 10 AM for the posts of Research Associates &amp; Senior Research Fellows (SRF) in the following DST/DBT/ICAR funded projects.</p>

<p>1 NPTC Project on Bioinformatics and Comparative Genomics</p>

<p>Research Associate (One)</p>

<p>Rs. 24000/- + 30% HRA for masters degree holder with more than 4 years experience</p>

<p>Essential: Ph D in Plant Molecular Biology &amp; Biotechnology/Genetics 0r Candidates who have already submitted their Ph D thesis in above subjects</p>

<p>Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.</p>

<p>Senior Research Fellow ( UGCCSIR/ DBT/ ICAR Net qualified only): (One)</p>

<p>Rs. 16000/- + 30% HRA and Rs. 18000+30 HRA from 3rd year onwards</p>

<p>Essential:</p>

<p>1. ICAR/ UGCCSIR/DBT Net qualified only</p>

<p>2. M. Sc. (with thesis) in Biotechnology, Life Sciences, Biosciences/ Bioinformatics, Genetics/ Plant Pathology with experience in molecular biology.</p>

<p>Or M.Sc with more than 3 years research experiences</p>

<p>3. B.Sc. Agriculture or Biology</p>

<p>Desirable:<br />1. M. Sc. with thesis<br />2. Experience in molecular biology, plant tissue culture<br />3. Bioinformatics knowledge is important</p>

<p>2 DST JC Bose National Fellowship</p>

<p>Research Associate (Bioinformatics) : One</p>

<p>Rs.22000/- + 30% HRA for 1 &amp; 2nd Yr., Rs. 23000+ 30% HRA for 3rd year and Rs. 24000+30% HRA for 4th &amp;5th yr</p>

<p>Essential: M Ph D in Plant Molecular Biology &amp; Biotechnology/Genetics</p>

<p>Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.</p>

<p>Age limit: Max.35 years (Age relaxation of 5 years for SC/ST &amp; women and 3 years for OBC)</p>

<p>The posts are purely temporary in nature and are co-terminus with the project. Initially the offer will be made for one year only and may be further extendable based on performance of the candidate. The interview will be held on May 23 , 2014 at 10:00 AM at NRCPB, LBS Building, Pusa Campus, IARI, New Delhi- 110012. The candidates must bring four copies of biodata (in the prescribed proforma), original certificates, attested photocopies of each of the certificates and an attested copy of recent passport size photograph. No. TA/DA would be given for the appearance in interview. Only the candidates having essential qualification would be entertained for the interviews. Short-listing of candidates based on academic merit and experience will be done in case of large number of applicants.</p>

<p>Advertisement: http://www.nrcpb.org/sites/default/files/Advertisement%20for%20RA%20and%20SRF%20Position.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/11144/scientists-map-17294-proteins-produced-in-human-body</guid>
	<pubDate>Thu, 29 May 2014 01:57:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/11144/scientists-map-17294-proteins-produced-in-human-body</link>
	<title><![CDATA[Scientists map 17,294 proteins produced in human body]]></title>
	<description><![CDATA[<p>Indian scientists missed the genomic profiling bus, but they've more than made up for it by creating the first human proteome map which is an extension of the genomic study. Till now, here is no direct equivalent for the human proteome. But recently two groups present mass spectrometry-based analysis of human tissues, body fluids and cells mapping the large majority of the human proteome.</p><p>The Indian scientists working in Bangalore, along with their American counterparts, have mapped more than 17,000 proteins in 30 organs of the human body. Just like the human genome was sequenced around the turn of the millennium, this is an equivalent mapping of the human proteome.<br /><br />The researcher estimated there are around 20,500 proteins in the human body. These scientists have profiled around 17,294, which account for around 84% of the total proteins. Apart from this, the team also traced around 2,500 of 3,000 proteins that had been categorised as "missing proteins".</p><p>The work, done by group of Indian scientists, and Johns Hopkins University, published in the renowned journal Nature ( http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html ). Of the 72 people who worked on the project, 46 are Indians.</p><p>Reference:</p><p>http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html</p><p>http://www.proteinatlas.org/ -The antibody-based Human Protein Atlas programme</p><p>http://www.humanproteomemap.org/ -Proteogenomic analysis by identifying translated proteins from annotated pseudogenes, non-coding RNAs and untranslated regions.</p><p>https://www.proteomicsdb.org/ -Assembled protein evidence for 18,097 genes in ProteomicsDB</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11582/monitor-running-jobs-on-linux-server</guid>
	<pubDate>Fri, 06 Jun 2014 16:18:43 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11582/monitor-running-jobs-on-linux-server</link>
	<title><![CDATA[Monitor running jobs on Linux server]]></title>
	<description><![CDATA[<p>You as a bioinformatican run lots of program on your servers. Sometime the shared server is also used by your colleague. If server is busy you sometime need to check the running programs and want to monitor the running programs as well. The "top" command will come in handy when you need to find out if things are still running, how long they&rsquo;ve been running, or how much memory is being used.<br /><br />&lsquo;top&rsquo; is very simple to run: type<br /><br />%% top<br /><br />You&rsquo;ll get a screen that looks like this, and is updated regularly:<br /><br /><img src="http://bioinformaticsonline.com/mod/photo/top.png" width="659" height="582" alt="image" style="border: 0px;"><br />Simple, right? Heh.<br /><br />First! Note that you can use &lsquo;q&rsquo; or &lsquo;CTRL-C&rsquo; to exit from &lsquo;top&rsquo;.<br /><br />Now let&rsquo;s read and understand at each line independently.<br /><br />The first line:<br /><br />top - 23:00:48 up 39 days,&nbsp; 2 user,&nbsp; load average: 0.00, 0.00, 0.00<br /><br />The first line tells you the current time, how long the machine has been up, how many users are logged in, and the short/medium/long-term compute load on the machine. If you run something for a long time, you&rsquo;ll see these numbers go up. Right now, the machine is basically just sitting there, so these are all close to 0.<br /><br />The second line:</p><p>Tasks:&nbsp; 239 total,&nbsp;&nbsp; 1 running,&nbsp; 238 sleeping,&nbsp;&nbsp; 0 stopped,&nbsp;&nbsp; 0 zombie<br /><br />This line tells you how many processes are running. If you are using laptops machines it&rsquo;s not so interesting because you really are the only one using this machine.<br /><br />Cpu(s):&nbsp; 0.0%us,&nbsp; 0.0%sy,&nbsp; 0.0%ni,100.0%id,&nbsp; 0.0%wa,&nbsp; 0.0%hi,&nbsp; 0.0%si,&nbsp; 0.0%st<br /><br />This line contains the CPU load. The first two numbers are how busy the system is doing computation (&ldquo;us&rdquo; stands for &ldquo;user&rdquo;) and how busy the system is doing system-y things like accessing disks or network (&ldquo;sy&rdquo; stands for &ldquo;system&rdquo;). We&rsquo;ll talk more about this later.<br /><br />Mem:&nbsp;&nbsp; 49457320k total,&nbsp;&nbsp;&nbsp; 3492174k used,&nbsp; 14535596k free,&nbsp;&nbsp;&nbsp; 1435148k buffers<br /><br />This should be easy to understand &ndash; how much memory you&rsquo;re using! <br /><br />Swap:&nbsp;&nbsp; 539356k total,&nbsp;&nbsp; 28332k used,&nbsp;&nbsp; 836562k free,&nbsp;&nbsp;&nbsp; 29862014k cached<br /><br />Swap is just on-disk memory that can be used to &ldquo;swap&rdquo; out programs from main memory. Again, we&rsquo;ll talk about this later.:<br /><br />PID USER&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; PR&nbsp; NI&nbsp; VIRT&nbsp; RES&nbsp; SHR S %CPU %MEM&nbsp;&nbsp;&nbsp; TIME+&nbsp; COMMAND<br />&nbsp; 1 root&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 39 &nbsp; 19&nbsp; 0&nbsp; 0&nbsp; 0 S&nbsp; 0.0&nbsp; 0.0&nbsp;&nbsp; 246:57.22 kipmi0<br />&nbsp; 2 root&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; RT&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp; 0&nbsp;&nbsp;&nbsp; 0 S&nbsp; 0.0&nbsp; 0.0&nbsp;&nbsp; 0:00.00 migration/0<br /><br />And... finally! What&rsquo;s actually running! The two most important numbers are the %CPU and %MEM towards the right, as well as the COMMAND. This tells you how compute- and memory-intensive your program is. Right now, nothing&rsquo;s running so the numbers aren&rsquo;t very interesting, but just wait until we run something...</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11441/assistant-professor-in-bioinformatics-at-dr-d-y-patil-biotechnology-bioinformatics-institute</guid>
  <pubDate>Tue, 03 Jun 2014 19:54:15 -0500</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor 	in Bioinformatics at Dr. D. Y. Patil Biotechnology &amp; Bioinformatics Institute]]></title>
  <description><![CDATA[
<p>Dr. D. Y. Patil Biotechnology &amp; Bioinformatics Institute <br />Tathawade, Pune 411033.</p>

<p>Assistant Professor 	in Bioinformatics </p>

<p>Essential :<br />First Class Master’s Degree in the appropriate branch of Life Sciences / Technology (Tech.)<br />OR<br />Ph.D in Life Sciences or in the respective subject area of specialization<br />OR<br />Good Academic record with at least 55% marks (or an equivalent grade) at the Master’s Degree level, in the relevant subject or an equivalent degree from an Indian / Foreign University.<br />Besides fulfilling the above qualifications, candidates should have cleared the eligibility test (NET) for lecturers conducted by the UGC, CSIR or similar test accredited by the UGC and as per the requirements of UGC guidelines.</p>

<p>Desirable :<br />Teaching, research industrial and/or professional experience in a reputed organization. <br />Papers presented at Conferences and/or in refereed journals</p>

<p>Note : Application are invited in prescribed form Click here for Application Form<br />Kindly send your applications to “Registrar, Dr. D. Y. Patil Vidyapeeth, Pune, Sant Tukaram Nagar, Pimpri, Pune – 411018., Maharashtra, India.” should reach in the University office within 15 days from the publication.</p>

<p>More Info: http://www.dpu.edu.in/BiotechResearchPositions.aspx</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11656/faculty-post-at-zhejiang-university</guid>
  <pubDate>Tue, 10 Jun 2014 03:40:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty post at Zhejiang University]]></title>
  <description><![CDATA[
<p>Zhejiang University (ZJU) is seeking faculty candidates for its newly launched, highly competitive and well funded “Hundred Talents Program”. This search covers all colleges and departments at ZJU. Applicants, expected to be about 35 years old, should hold PhD degree, and postdoctoral experiences are preferred for applicants in most fields. Applicants should have demonstrated commitment to excellence in teaching and research at a level comparable to the academic achievement of assistant professor or associate professor in world-renowned universities. Successful candidates must work full-time and are expected to establish internationally competitive and independent research program in cutting-edge areas of the relevant field at ZJU.</p>

<p>As one of the leading research-intensive universities in China, ZJU is located in the beautiful city of Hangzhou. Successful candidates will be employed as Principal Investigators and are qualified to supervise doctoral students. ZJU will offer an internationally competitive salary and the opportunity to purchase university's apartment at a price much lower than the market price, and will provide office and laboratory spaces as well as internationally competitive research startup packages.</p>

<p>Qualified applicants are strongly encouraged to submit their applications electronically to tr@zju.edu.cn. Applicants should include the following materials in pdf format: a comprehensive CV, a statement of research and teaching plan, and a list of 3 to 5 references with detailed contact information.</p>

<p>Contact：Talents Office, ZJU</p>

<p>Tel：+86-571-88981345, +86-571-88981390</p>

<p>Fax：+86-571-88981976</p>

<p>E-mail:tr@zju.edu.cn</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</guid>
	<pubDate>Tue, 24 Jun 2014 07:58:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</link>
	<title><![CDATA[Genomic Medicine - Bruce Korf (2014)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/FYldIrsXHKw" frameborder="0" allowfullscreen></iframe>May 21, 2014 - Current Topics in Genome Analysis 2014
A lecture series covering contemporary areas in genomics and bioinformatics. More: http://www.genome.gov/COURSE2014]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12594/faculty-positions-at-central-university-of-punjab</guid>
  <pubDate>Mon, 07 Jul 2014 23:33:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty Positions at Central University of Punjab]]></title>
  <description><![CDATA[
<p>Faculty Positions: Rolling/Open Advertisement Advt.No: T-10 (2013)</p>

<p>Pay Scale: Pay Band Rs.15600-39100 with AGP of Rs.6,000/-</p>

<p>Essential Qualifications for Professors, Associate Professors, and Assistant Professors: As per “UGC REGULATIONS ON MINIMUM QUALIFICATIONS FOR APPOINTMENT OF TEACHERS AND OTHER ACADEMIC STAFF IN UNIVERSITIES AND COLLEGES AND MEASURES FOR THE MAINTENANCE OF STANDARDS IN HIGHER EDUCATION 2010“ and the 2nd Amendments to the regulation issued in June 2013.</p>

<p>For details: http://www.ugc.ac.in/oldpdf/regulations/revised_finalugcregulationfinal10.pdf http://www.ugc.ac.in/pdfnews/8539300_English.pdf and University rules.</p>

<p>Procedure to apply:</p>

<p>Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 500/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:</p>

<p>Registrar, Central University of Punjab, City Campus, Mansa Road, Bathinda-151001</p>

<p>For more info visit: http://www.centralunipunjab.com/Teaching/Final%20Details-t10-2013.pdf, http://www.centralunipunjab.com/Teaching/Advertisement-t10-2013.jpg</p>

<p>Last Apply Date: 31 Dec 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12995/national-center-for-bioinformatics-ncb</guid>
  <pubDate>Wed, 23 Jul 2014 14:10:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Center for Bioinformatics (NCB)]]></title>
  <description><![CDATA[
<p>NCB is offering M.Phil and Ph.D programs in the area of Bioinformatics. The major goal of NCB is to promote quality training and research in the area of Bioinformatics. Bioinformatics originated as a cross-disciplinary field as the need for computational sections to research problem raised in biomedicine. </p>

<p>More at http://ncb.qau.edu.pk/</p>
]]></description>
</item>

</channel>
</rss>