<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/11181?offset=730</link>
	<atom:link href="https://bioinformaticsonline.com/related/11181?offset=730" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12594/faculty-positions-at-central-university-of-punjab</guid>
  <pubDate>Mon, 07 Jul 2014 23:33:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty Positions at Central University of Punjab]]></title>
  <description><![CDATA[
<p>Faculty Positions: Rolling/Open Advertisement Advt.No: T-10 (2013)</p>

<p>Pay Scale: Pay Band Rs.15600-39100 with AGP of Rs.6,000/-</p>

<p>Essential Qualifications for Professors, Associate Professors, and Assistant Professors: As per “UGC REGULATIONS ON MINIMUM QUALIFICATIONS FOR APPOINTMENT OF TEACHERS AND OTHER ACADEMIC STAFF IN UNIVERSITIES AND COLLEGES AND MEASURES FOR THE MAINTENANCE OF STANDARDS IN HIGHER EDUCATION 2010“ and the 2nd Amendments to the regulation issued in June 2013.</p>

<p>For details: http://www.ugc.ac.in/oldpdf/regulations/revised_finalugcregulationfinal10.pdf http://www.ugc.ac.in/pdfnews/8539300_English.pdf and University rules.</p>

<p>Procedure to apply:</p>

<p>Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 500/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:</p>

<p>Registrar, Central University of Punjab, City Campus, Mansa Road, Bathinda-151001</p>

<p>For more info visit: http://www.centralunipunjab.com/Teaching/Final%20Details-t10-2013.pdf, http://www.centralunipunjab.com/Teaching/Advertisement-t10-2013.jpg</p>

<p>Last Apply Date: 31 Dec 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12995/national-center-for-bioinformatics-ncb</guid>
  <pubDate>Wed, 23 Jul 2014 14:10:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Center for Bioinformatics (NCB)]]></title>
  <description><![CDATA[
<p>NCB is offering M.Phil and Ph.D programs in the area of Bioinformatics. The major goal of NCB is to promote quality training and research in the area of Bioinformatics. Bioinformatics originated as a cross-disciplinary field as the need for computational sections to research problem raised in biomedicine. </p>

<p>More at http://ncb.qau.edu.pk/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13276/senior-research-fellow-at-nit-rourkela</guid>
  <pubDate>Wed, 30 Jul 2014 00:53:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow at NIT, Rourkela]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, ROURKELA – 769 008(ORISSA)<br />SPONSORED RESEARCH, INDUSTRIAL CONSULTANCY &amp; CONTINUING EDUCATION</p>

<p>ADVERTISEMENT NO: NITR/SR/CH-BIF/2014/30</p>

<p>Applications are invited on prescribed format for the following assignment in a purely time bound research project undertaken in the Department of Biotechnology &amp; Medical Engineering of the Institute.</p>

<p>1. Name of the Temporary Post : Senior Research Fellow-01<br />2. Name of the Research Project: “ Bioinformatics Infrastructure Facility (BIF)”<br />3. Name of the Sponsoring Agency: DBT, Government of India, 4 Tenure of the Project : 12th Five year Plan<br />5 Tenure of the Assignment : 01 year [Likely to be extended for 04 more years]<br />6 Job Description : BIF Maintenance and Active Research in Bioinformatics<br />7. Consolidated monthly compensation / Fellowship: Rs.18,000/- P.M.</p>

<p>8. Essential Qualifications and experience: B.Tech with valid GATE Score or M.Tech degree in Biotechnology/Bioinformatics/Computer Science/Computational Biology<br />9. Desirable Qualifications/ Experiences: Experience of Programming in PERL,R, Python, Unix and Visual Studio + Knowledge in NGS data analysis work flows ,WGS and statistical packages such as CRAN-R,MATLAB etc.</p>

<p>10. Accommodation : Bachelor accommodation in the Institute may be provided subject to availability.<br />11. For technical information on the project, the candidate may contact the Principal Investigator at the following address:</p>

<p>Name : Prof. Mukesh K Gupta<br />Address : Dept. of Biotechnology &amp; Medical Engineering,<br />N.I.T.Rourkela-769 008<br />Telephone No : 0661-2462294<br />E-mail : guptam@nitrkl.ac.in</p>

<p>Eligible persons may apply in the prescribed format (available in the Institute Website)affixed with coloured photographs to be submitted in duplicate along with photo copies of relevant certificates, grade/ mark sheets, publications etc., to Asst. Registrar, SRICCE,<br />National Institute of Technology, Rourkela–769 008 before 22.08.2014. The cover should be super- scribed clearly the post applied for &amp; Name of the Project.</p>

<p>Mere possession of minimum qualification does not guarantee invitation to the interview.<br />Candidates will be short listed based on merit and need of the project.</p>

<p>Advertisement:</p>

<p>http://www.nitrkl.ac.in/IntraWeb/Jobs_Tenders/Jobs/ProjectFellowship/2014/141707192838_1.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13510/studentship-and-traineeship-in-bioinformatics-at-barkatullah-university-bhopal</guid>
  <pubDate>Thu, 07 Aug 2014 16:57:00 -0500</pubDate>
  <link></link>
  <title><![CDATA[Studentship and Traineeship in Bioinformatics at Barkatullah University, Bhopal]]></title>
  <description><![CDATA[
<p>Department of Biotechnology &amp; Bioinformatics Center<br />Barkatullah University, Bhopal – 462 026</p>

<p>Studentship and Traineeship in Bioinformatics</p>

<p>Applications are invited on plain paper from suitable candidates for Studentship and Traineeship (One each) at Bioinformatics Sub-Center as detailed below:</p>

<p>1. Studentship: Studentship is for those who have completed M. Sc. Degrees in Life Science.</p>

<p>Number of seats : One</p>

<p>Duration : Six months</p>

<p>Eligibility : Passed M.Sc. degree in Life Sciences.</p>

<p>Fellowship : Rs. 5000/- (Five thousand only) per month</p>

<p>2. Traineeship: Traineeship is for those who have completed M. Sc. Degrees in Life Science/Registered Ph. D. student in Life Sciences.</p>

<p>Number of seats : One</p>

<p>Duration : Six months</p>

<p>Eligibility : Passed M.Sc. degree in Life Sciences/ Registered Ph. D. student in Life Sciences</p>

<p>Fellowship : Rs. 5000/- (Five thousand only) per month</p>

<p>Preferences will be given to person who has experience in Bioinformatics and Computer<br />sciences. The application along with detailed bio-data should reach the undersigned, on or before 25th August 2014. Both, the studentship and the traineeship are temporary, will be discontinued after the six months from the date of Joining. It may be discontinued in-between without any notice, if the work is not found satisfactory.</p>

<p>Advertisement www.bioinfobubpl.nic.in/Advertisement_st.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</guid>
	<pubDate>Fri, 28 Sep 2018 09:35:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</link>
	<title><![CDATA[GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences]]></title>
	<description><![CDATA[<p>GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:</p>
<ul>
<li>Step 1. Run mugsy to get multiple sequence alignment results.</li>
<li>Step 2 &amp; 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.</li>
<li>Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.</li>
<li></li>
<li></li>
</ul>
<p>https://github.com/DanwangJessica/GRSR</p><p>Address of the bookmark: <a href="https://github.com/DanwangJessica/GRSR" rel="nofollow">https://github.com/DanwangJessica/GRSR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/14011/dynamic-chromosome-breakpoints</guid>
	<pubDate>Wed, 13 Aug 2014 18:38:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/14011/dynamic-chromosome-breakpoints</link>
	<title><![CDATA[Dynamic chromosome breakpoints !!!]]></title>
	<description><![CDATA[<p>Cell division involves the distribution of identical genetic material, DNA, to two daughters&rsquo; cells. During this process, duplicated deoxyribonucleic acid (DNA) goes through a condensation and decondensation process. This is followed by nuclear envelope dissolution, mitotic spindle assembly, migration of the sister chromatid pairs to the metaphase plate, division and segregation of identical sets of chromosomes into daughter nuclei and nuclear envelope reformation.</p><p>The vital metaphase stage of cell division, when the sister chromatids migrated to the centre and lined up in a row, and pulled apart using attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chromosomes are free to undergo <strong>recombination </strong>which involves the exchange of genetic material either between multiple chromosomes or between different regions of the same chromosome.</p><p><img src="http://www.sciencelearn.org.nz/var/sciencelearn/storage/images/contexts/uniquely-me/sci-media/images/chromosomes-crossing-over/464438-1-eng-NZ/Chromosomes-crossing-over.jpg" alt="image" width="504" height="342" style="border: 0px; border: 0px;"></p><p>During recombination, the precise breakage of each strand, exchange between the strands, and sealing of the resulting recombined molecules happens. The &ldquo;<strong>chromosomal breakpoints</strong>&rdquo; refers to these places where they break. Mostly, this process occurs with a high degree of accuracy at high frequency in both eukaryotic and prokaryotic cells. But occasionally this &ldquo;break and sealing/ break and reattach&rdquo; process goes wrong and the reattachment happens in the wrong place which usually create disaster (with few exceptions).These chromosome disaster or abnormalities involve the gain, loss or rearrangement of visible amounts of genetic material during cell division. These abnormalities are of two type, the first one is numerical abnormalities &nbsp;where severe disorders are caused by the loss or gain of whole chromosomes, which affect the copy number of hundreds or even thousands of genes. The second are structural abnormalities which can be unbalanced or balanced. The former are similar to numerical abnormalities in that genetic material is either gained or lost. The natural defects in chromosome segregation are linked to cancer and several genetic diseases (http://en.wikipedia.org/wiki/List_of_genetic_disorders). Therefore, the enzymes involved in regulating cell division are still the attractive drug targets for many diseases.</p><p>&nbsp;</p><p>&nbsp;</p><p><img src="http://upload.wikimedia.org/wikipedia/commons/4/4a/Chromosomal_translocations.svg" alt="image" width="424" height="331" style="border: 0px; border: 0px;"></p><p>&nbsp;</p><p>Apart from certain chromosome abnormalities, these &ldquo;crossing over&rdquo; of segments of maternal and paternal chromosomes to form hybrid chromosomes have some evolutionary importance and considered as a driver of genetic variation. Moreover, the chromosome breakage in evolution is considered to be non-random in nature(http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0020014). In addition the study of breakpoint regions and non-breakpoint (stable) regions of chromosomes indicates both the regions evolved in distinctly different ways ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675965/). These breakage may lead to genetic diseases or participate to chromosomal rearranmgnets and contributed in development of new species.</p><p>I will try to explain the genome hotspots/Evolutionary Breakpoint Regions(EBRs)/fragile regions/weak fragments/&nbsp; in my next blog.</p><p><strong>Software for recombination detection:</strong></p><p><strong>RAT</strong> http://cbr.jic.ac.uk/dicks/software/RAT/</p><p><strong>Breakpointer</strong> https://github.com/ruping/Breakpointer</p><p><strong>DRP</strong> http://web.cbio.uct.ac.za/~darren/rdp.html</p><p><strong>RB-finder</strong> http://www.ncbi.nlm.nih.gov/pubmed/18707535</p><p><strong>LDhat2.0</strong> http://ldhat.sourceforge.net/LDhat2.0/instructions.shtml</p><p><strong>Reference:</strong></p><p>http://www.nature.com/scitable/topicpage/genetic-recombination-514#</p><p>Image: Wikipedia , sciencelearn.org.nz</p><p><strong>Recommended Articles:</strong></p><p>http://www.friendshipcircle.org/blog/2012/05/22/13-chromosomal-disorders-youve-never-heard-of/</p><p>http://web.udl.es/usuaris/e4650869/docencia/segoncicle/genclin98/recursos_classe_%28pdf%29/revisionsPDF/chromosyndromes.pdf</p><p>http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2775595/table/T2/</p><p>http://learn.genetics.utah.edu/content/disorders/chromosomal/</p><p>http://www.ncert.nic.in/html/learning_basket/biology/cc&amp;cd.pdf</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/14183/guest-faculty-at-pondicherry-university</guid>
  <pubDate>Wed, 20 Aug 2014 00:37:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Guest Faculty at Pondicherry University]]></title>
  <description><![CDATA[
<p>Pondicherry University, India</p>

<p>Walk in interview for guest faculty in Pondicherry University, India. For more information please visit http://www.bicpu.edu.in/bioinfor140814.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/14339/apps-for-busy-bioinformatics-researchers</guid>
	<pubDate>Mon, 25 Aug 2014 01:26:19 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/14339/apps-for-busy-bioinformatics-researchers</link>
	<title><![CDATA[Apps for Busy Bioinformatics Researchers !!!]]></title>
	<description><![CDATA[<h3>DNAApp:</h3><h4><strong>DNAApp: for </strong><a href="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8" target="_blank"><strong>iPhone/iPad</strong></a></h4><p>This is an <a href="http://www.apple.com/ios/" target="_blank" title="IOS">iOS</a> app that allows for the opening and analysis of <a href="http://en.wikipedia.org/wiki/DNA_sequencing" target="_blank" title="DNA sequencing">DNA sequencing</a> files - ab1. It includes handy tools such as "<a href="http://en.wikipedia.org/wiki/Complementarity_%28molecular_biology%29" target="_blank" title="Complementarity (molecular biology)">Reverse Complement</a>", "Jump to", "<a href="http://en.wikipedia.org/wiki/Cut%2C_copy%2C_and_paste" target="_blank" title="Cut, copy, and paste">Copy and Paste</a> sequences", fast and end scrolling, "<a href="http://en.wikipedia.org/wiki/Chromatography" target="_blank" title="Chromatography">Chromatogram</a> adjustments", and "Searching for segments" functions. <br /> When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files. <br /> This app works with cloud storage access like Dropbox to your sequencing files. <br /> This is now compatible with the new update for iOS 7.1. <br /> Demo video can be found at:<strong> https://www.youtube.com/watch?v=mXeo9hXdZgM&nbsp;</strong></p><p><strong>More @ </strong><a href="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8" target="_blank" title="https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8"><strong>https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8</strong></a></p><h4><a href="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en" target="_blank"><strong>DNAApp: For android</strong></a></h4><p>This is the first android app that allows for the opening and analysis of DNA sequencing files - ab1. It includes handy tools such as "Reverse Complement", "Jump to", fast and end scrolling, "Chromatogram adjustments", amino acid translations, "export to fasta", and "searching for segment" function.</p><ul>
<li>When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files.</li>
<li>This app works with cloud storage access like Dropbox to your sequencing files.</li>
<li>This is now compatible with the new update for <a href="http://code.google.com/android/" target="_blank" title="Android">Android</a> 4.4.2.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en"><strong>https://play.google.com/store/apps/details?id=bii.seqdatreader&amp;hl=en</strong></a></p><h3>BioGene:iPhone/iPad</h3><p>BioGene is an information tool for biological research. Use BioGene to learn about gene function. Enter a gene symbol or gene name, for example "CDK4" or "cyclin dependent kinase 4" and BioGene will retrieve its gene function and references into its function (<a href="http://en.wikipedia.org/wiki/GeneRIF" target="_blank" title="GeneRIF">GeneRIF</a>).</p><ul>
<li>BioGene was produced in affiliation with the Computational Biology Center at <a href="http://maps.google.com/maps?ll=40.764096,-73.956842&amp;spn=0.01,0.01&amp;q=40.764096,-73.956842%20%28Memorial%20Sloan%E2%80%93Kettering%20Cancer%20Center%29&amp;t=h" target="_blank" title="Memorial Sloan&ndash;Kettering Cancer Center">Memorial Sloan-Kettering Cancer Center</a> with primary information from Entrez Gene at the <a href="http://maps.google.com/maps?ll=38.994994,-77.099339&amp;spn=0.01,0.01&amp;q=38.994994,-77.099339%20%28National%20Center%20for%20Biotechnology%20Information%29&amp;t=h" target="_blank" title="National Center for Biotechnology Information">NCBI</a>.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/biogene/id333180084?mt=8" target="_blank" title="https://itunes.apple.com/us/app/biogene/id333180084?mt=8"><strong>https://itunes.apple.com/us/app/biogene/id333180084?mt=8</strong></a></p><h3>Mentha - the interactome browser: Android</h3><p>About: mentha - the interactome browser, is a project that offers protein-protein physical/enzymatic interaction information from various sources. For more details about mentha, visit mentha's website. This client application is an independent project. This application is designed to allow you to search proteins on the go.</p><h4><strong>Key features (Also in website):</strong></h4><ul>
<li>Search proteins by <a href="http://en.wikipedia.org/wiki/UniProt" target="_blank" title="UniProt">UniProt</a> IDs, gene name or keywords</li>
<li>Collect proteins from different queries.</li>
<li>Spot common interactors in clusters.</li>
<li>Easily distinguish between proteins from Homo sapiens and other organisms (Yellow rounded rectangles)</li>
<li>Click on edges(links) to get scientific evidence.</li>
<li>Click on proteins to see descriptions.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en"><strong>https://play.google.com/store/apps/details?id=com.sinnefa.mentha&amp;hl=en</strong></a></p><h3>GeneIndex: iPhone/iPad</h3><p>GeneIndex quickly provides information about genes from various sources. It also includes a RSS reader for journal feeds as well as a PubMed viewer.</p><h4><strong>Key Features:</strong></h4><ul>
<li>Look up genes by symbol or description.</li>
<li>Gene indexes for many mammals, plants, invertebrates, and bacteria.</li>
<li>Link to gene info on websites.</li>
<li>Download files for offline use. (.pdf, .mp3, .m4v, .doc, .ppt, .xls )</li>
<li>transfer files via open in, email, or iTunes file sharing</li>
<li>View RSS feeds for journals</li>
<li>Query GeneRIF interactions, COSMIC mutations, and CNV data for cell lines.</li>
<li>Does not require a network connection for local databases.</li>
<li>View and search PubMed in table view.</li>
</ul><p><br /> GeneIndex provides a convenient and portable way to lookup gene symbols while at a seminar, conference, or lab meeting. Genes are linked to common life science websites such as NCBI, COSMIC, KEGG, PubMed, SymAtlas, UCSC genome browser, Pathway Commons, Genatlas, Wikipedia, HUGO, and OMIM. GeneRIF gene interactions can also be queried.</p><ul>
<li>Keep current on the scientific literature. GeneIndex includes a RSS reader and web browser for browsing popular journals like Nature, Science, and Cell. You can also add your own RSS feeds. PDFs and podcasts can be saved as files that you can view on the device or email as attachments.</li>
<li>Examine the status of genes in common cell lines. A subset of COSMIC containing cell lines can be queried for mutations. Copy Number Variation (CNV) plots from cell lines profiled by GSK and Sanger are also linked to genes.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/geneindex/id319769866?mt=8" target="_blank" title="https://itunes.apple.com/us/app/geneindex/id319769866?mt=8"><strong>https://itunes.apple.com/us/app/geneindex/id319769866?mt=8</strong></a></p><h3>Genome Voyager: iPad</h3><p>Gain first hand experience identifying the genomic basis of disease by analyzing cases with whole genome sequencing data that have been published for research and learning purposes.</p><ul>
<li>Visualize whole human genome sequencing data including small variations, copy number variations (CNVs), and loss of heterozygosity (LOH) events</li>
<li>Quickly find variants of interest by filtering variants based on associated genes, functional impact, allele frequency in data sets, and cross-references with various genomic databases.</li>
<li>Collaborate on variant assessments with other researchers and academics to improve knowledge of both pathogenic and benign variants. <br /> To use Genome Voyager, users must join Genome Voyager&rsquo;s community of researchers and academics. Visit <strong>http://voyager.completegenomics.com to signup.</strong></li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8" target="_blank" title="https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8"><strong>https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8</strong></a></p><h3>YeastGenome: iPhone/iPad</h3><p>Use YeastGenome to quickly find fundamental information about Saccharomyces cerevisae genes and chromosomal features. Search gene names, gene descriptions or browse the database to find information about your favorite gene, as well as more detailed information such as Gene Ontology, mutant phenotype, and protein and genetic interaction data. <br /> YeastGenome contains the latest from the Saccharomyces Genome Database (www.yeastgenome.org) in an on bound app database. As more detailed information is presented the app switches to web services access to SGD, and then for even more details provides complete information via hyperlinks to the appropriate SGD database pages.</p><h4><strong>Key features:</strong></h4><ul>
<li>Search using gene name or keywords</li>
<li>Browse by feature type</li>
<li>Save your favorite features</li>
<li>Can be used in airplane mode</li>
<li>Email information about features to collaborators</li>
</ul><h4><strong>What's New in Version 1.8.1</strong></h4><ul>
<li>This update is required to provide continued functionality. Some of the data provided by this app accesses the SGD service using a method that is changing in May 2013. This version provides changes to allow access to continue. The on board database of yeast gene information has also been updated to March 2013.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8" target="_blank" title="https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8"><strong>https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8</strong></a></p><h3>SNPdbe: iPhone/iPad</h3><p>SNPdbe &mdash; SNP database of effects, with predictions of computationally annotated functional impacts of SNPs. Database entries represent nsSNPs in dbSNP and 1000 Genomes collection, as well as variants from UniProt and PMD. SAASs come from &gt;2600 organisms; &lsquo;human&rsquo; being the most prevalent. The impact of each SAAS on protein function is predicted using the SNAP and SIFT algorithms and augmented with experimentally derived function/structure information and disease associations from PMD, OMIM and UniProt.</p><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8" target="_blank" title="https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8"><strong>https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8</strong></a></p><h3>SimGene: iPhone/iPad / Android</h3><h4><strong>SimGene: for iPhone/iPad </strong></h4><p>SimGene is an iPhone/iPad/iPod touch application designed for molecular biologists, bioinformaticians and medical researchers. The application interfaces with Simbiot, Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations and many other databases to retrieve up-to-date annotation information for over 30 species, based on gene symbol search. The application provides gene and transcript cross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene also contains an integrated genome browser with information on genes, transcripts, exons and SNPs.</p><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/simgene/id427772349?mt=8" target="_blank" title="https://itunes.apple.com/us/app/simgene/id427772349?mt=8"><strong>https://itunes.apple.com/us/app/simgene/id427772349?mt=8</strong></a></p><h4><strong>SimGene: for Android</strong></h4><p>bioinformaticians and medical researchers. The application interfaces with Simbiot,Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations andmany other databases to retrieve up-to-date annotation information for over 30species, based on gene symbol search. The application provides gene and transcriptcross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene alsocontains an integrated genome browser with information on genes, transcripts,exons and SNPs.</p><p><strong>More @&nbsp; </strong><a href="https://play.google.com/store/apps/details?id=com.japanbioinformatics.simgene&amp;hl=en" target="_blank" title="https://play.google.com/store/apps/details?id=com.japanbioinformatics.simgene&amp;hl=en"><strong>https://play.google.com/store/apps/details?</strong></a></p><h3>TimeTree: iPhone/iPad</h3><p>TimeTree is a public knowledge-base for information on the evolutionary timescale of life. This application allows easy exploration of the thousands of divergence times among organisms in the scientific literature. A tree-based (hierarchical) system is used to identify all published molecular time estimates bearing on the divergence of two chosen organisms, such as species, compute summary statistics, and present the results. Names of two taxa to be compared are entered in the search window and the results are presented on a set of self-explanatory tabs.</p><ul>
<li>TimeTree 3.0 was released September 27, 2011 with new data from 1209 studies including 25342 time nodes. We will be adding more data in the future as it comes in from researchers.</li>
<li>TimeTree is jointly directed by Blair Hedges (Pennsylvania State University) and Sudhir Kumar (Arizona State University). This project has been supported, in part, by grants from the National Science Foundation, National Institutes of Health, NASA Astrobiology Institute, and Science Foundation of Arizona.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/timetree/id372842500?mt=8" target="_blank" title="https://itunes.apple.com/us/app/timetree/id372842500?mt=8"><strong>https://itunes.apple.com/us/app/timetree/id372842500?mt=8</strong></a></p><h3><strong>GeneGroove: iPhone/iPad </strong></h3><p>GeneGroove is the first application to create a music melody from DTC-Genomics data. If you own 23andMe (Mountain View, CA) personal genomic results, GeneGroove will create for you a unique melody intimately based on your 23andMe genome informations. The music in you.</p><ul>
<li>After uploading your 23andMe raw data onto your iPhone via iTunes, GeneGroove will analyze your genome informations and generate a unique identifier key. This key, called the GeNumber, will embed the uniqueness of your genome data while keeping your privacy safe, and will be used by GeneGroove to generate your music melody.</li>
<li>The GeNumber doesn't contain anymore genomic information but it is based on your genome and it is unique, it is yours. It will be used in upcoming Portable Genomics applications to mix and remix music, manipulate sounds and share your art with your friends and family.</li>
</ul><p><strong>More @&nbsp; </strong><a href="https://itunes.apple.com/us/app/genegroove/id492247404?mt=8" target="_blank" title="https://itunes.apple.com/us/app/genegroove/id492247404?mt=8"><strong>https://itunes.apple.com/us/app/genegroove/id492247404?mt=8</strong></a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

</channel>
</rss>