<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/11181?offset=780</link>
	<atom:link href="https://bioinformaticsonline.com/related/11181?offset=780" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11656/faculty-post-at-zhejiang-university</guid>
  <pubDate>Tue, 10 Jun 2014 03:40:40 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty post at Zhejiang University]]></title>
  <description><![CDATA[
<p>Zhejiang University (ZJU) is seeking faculty candidates for its newly launched, highly competitive and well funded “Hundred Talents Program”. This search covers all colleges and departments at ZJU. Applicants, expected to be about 35 years old, should hold PhD degree, and postdoctoral experiences are preferred for applicants in most fields. Applicants should have demonstrated commitment to excellence in teaching and research at a level comparable to the academic achievement of assistant professor or associate professor in world-renowned universities. Successful candidates must work full-time and are expected to establish internationally competitive and independent research program in cutting-edge areas of the relevant field at ZJU.</p>

<p>As one of the leading research-intensive universities in China, ZJU is located in the beautiful city of Hangzhou. Successful candidates will be employed as Principal Investigators and are qualified to supervise doctoral students. ZJU will offer an internationally competitive salary and the opportunity to purchase university's apartment at a price much lower than the market price, and will provide office and laboratory spaces as well as internationally competitive research startup packages.</p>

<p>Qualified applicants are strongly encouraged to submit their applications electronically to tr@zju.edu.cn. Applicants should include the following materials in pdf format: a comprehensive CV, a statement of research and teaching plan, and a list of 3 to 5 references with detailed contact information.</p>

<p>Contact：Talents Office, ZJU</p>

<p>Tel：+86-571-88981345, +86-571-88981390</p>

<p>Fax：+86-571-88981976</p>

<p>E-mail:tr@zju.edu.cn</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</guid>
	<pubDate>Tue, 24 Jun 2014 07:58:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/12288/genomic-medicine-bruce-korf-2014</link>
	<title><![CDATA[Genomic Medicine - Bruce Korf (2014)]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/FYldIrsXHKw" frameborder="0" allowfullscreen></iframe>May 21, 2014 - Current Topics in Genome Analysis 2014
A lecture series covering contemporary areas in genomics and bioinformatics. More: http://www.genome.gov/COURSE2014]]></description>
	
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12594/faculty-positions-at-central-university-of-punjab</guid>
  <pubDate>Mon, 07 Jul 2014 23:33:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty Positions at Central University of Punjab]]></title>
  <description><![CDATA[
<p>Faculty Positions: Rolling/Open Advertisement Advt.No: T-10 (2013)</p>

<p>Pay Scale: Pay Band Rs.15600-39100 with AGP of Rs.6,000/-</p>

<p>Essential Qualifications for Professors, Associate Professors, and Assistant Professors: As per “UGC REGULATIONS ON MINIMUM QUALIFICATIONS FOR APPOINTMENT OF TEACHERS AND OTHER ACADEMIC STAFF IN UNIVERSITIES AND COLLEGES AND MEASURES FOR THE MAINTENANCE OF STANDARDS IN HIGHER EDUCATION 2010“ and the 2nd Amendments to the regulation issued in June 2013.</p>

<p>For details: http://www.ugc.ac.in/oldpdf/regulations/revised_finalugcregulationfinal10.pdf http://www.ugc.ac.in/pdfnews/8539300_English.pdf and University rules.</p>

<p>Procedure to apply:</p>

<p>Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 500/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:</p>

<p>Registrar, Central University of Punjab, City Campus, Mansa Road, Bathinda-151001</p>

<p>For more info visit: http://www.centralunipunjab.com/Teaching/Final%20Details-t10-2013.pdf, http://www.centralunipunjab.com/Teaching/Advertisement-t10-2013.jpg</p>

<p>Last Apply Date: 31 Dec 2014</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/12995/national-center-for-bioinformatics-ncb</guid>
  <pubDate>Wed, 23 Jul 2014 14:10:49 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Center for Bioinformatics (NCB)]]></title>
  <description><![CDATA[
<p>NCB is offering M.Phil and Ph.D programs in the area of Bioinformatics. The major goal of NCB is to promote quality training and research in the area of Bioinformatics. Bioinformatics originated as a cross-disciplinary field as the need for computational sections to research problem raised in biomedicine. </p>

<p>More at http://ncb.qau.edu.pk/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13276/senior-research-fellow-at-nit-rourkela</guid>
  <pubDate>Wed, 30 Jul 2014 00:53:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow at NIT, Rourkela]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, ROURKELA – 769 008(ORISSA)<br />SPONSORED RESEARCH, INDUSTRIAL CONSULTANCY &amp; CONTINUING EDUCATION</p>

<p>ADVERTISEMENT NO: NITR/SR/CH-BIF/2014/30</p>

<p>Applications are invited on prescribed format for the following assignment in a purely time bound research project undertaken in the Department of Biotechnology &amp; Medical Engineering of the Institute.</p>

<p>1. Name of the Temporary Post : Senior Research Fellow-01<br />2. Name of the Research Project: “ Bioinformatics Infrastructure Facility (BIF)”<br />3. Name of the Sponsoring Agency: DBT, Government of India, 4 Tenure of the Project : 12th Five year Plan<br />5 Tenure of the Assignment : 01 year [Likely to be extended for 04 more years]<br />6 Job Description : BIF Maintenance and Active Research in Bioinformatics<br />7. Consolidated monthly compensation / Fellowship: Rs.18,000/- P.M.</p>

<p>8. Essential Qualifications and experience: B.Tech with valid GATE Score or M.Tech degree in Biotechnology/Bioinformatics/Computer Science/Computational Biology<br />9. Desirable Qualifications/ Experiences: Experience of Programming in PERL,R, Python, Unix and Visual Studio + Knowledge in NGS data analysis work flows ,WGS and statistical packages such as CRAN-R,MATLAB etc.</p>

<p>10. Accommodation : Bachelor accommodation in the Institute may be provided subject to availability.<br />11. For technical information on the project, the candidate may contact the Principal Investigator at the following address:</p>

<p>Name : Prof. Mukesh K Gupta<br />Address : Dept. of Biotechnology &amp; Medical Engineering,<br />N.I.T.Rourkela-769 008<br />Telephone No : 0661-2462294<br />E-mail : guptam@nitrkl.ac.in</p>

<p>Eligible persons may apply in the prescribed format (available in the Institute Website)affixed with coloured photographs to be submitted in duplicate along with photo copies of relevant certificates, grade/ mark sheets, publications etc., to Asst. Registrar, SRICCE,<br />National Institute of Technology, Rourkela–769 008 before 22.08.2014. The cover should be super- scribed clearly the post applied for &amp; Name of the Project.</p>

<p>Mere possession of minimum qualification does not guarantee invitation to the interview.<br />Candidates will be short listed based on merit and need of the project.</p>

<p>Advertisement:</p>

<p>http://www.nitrkl.ac.in/IntraWeb/Jobs_Tenders/Jobs/ProjectFellowship/2014/141707192838_1.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/13510/studentship-and-traineeship-in-bioinformatics-at-barkatullah-university-bhopal</guid>
  <pubDate>Thu, 07 Aug 2014 16:57:00 -0500</pubDate>
  <link></link>
  <title><![CDATA[Studentship and Traineeship in Bioinformatics at Barkatullah University, Bhopal]]></title>
  <description><![CDATA[
<p>Department of Biotechnology &amp; Bioinformatics Center<br />Barkatullah University, Bhopal – 462 026</p>

<p>Studentship and Traineeship in Bioinformatics</p>

<p>Applications are invited on plain paper from suitable candidates for Studentship and Traineeship (One each) at Bioinformatics Sub-Center as detailed below:</p>

<p>1. Studentship: Studentship is for those who have completed M. Sc. Degrees in Life Science.</p>

<p>Number of seats : One</p>

<p>Duration : Six months</p>

<p>Eligibility : Passed M.Sc. degree in Life Sciences.</p>

<p>Fellowship : Rs. 5000/- (Five thousand only) per month</p>

<p>2. Traineeship: Traineeship is for those who have completed M. Sc. Degrees in Life Science/Registered Ph. D. student in Life Sciences.</p>

<p>Number of seats : One</p>

<p>Duration : Six months</p>

<p>Eligibility : Passed M.Sc. degree in Life Sciences/ Registered Ph. D. student in Life Sciences</p>

<p>Fellowship : Rs. 5000/- (Five thousand only) per month</p>

<p>Preferences will be given to person who has experience in Bioinformatics and Computer<br />sciences. The application along with detailed bio-data should reach the undersigned, on or before 25th August 2014. Both, the studentship and the traineeship are temporary, will be discontinued after the six months from the date of Joining. It may be discontinued in-between without any notice, if the work is not found satisfactory.</p>

<p>Advertisement www.bioinfobubpl.nic.in/Advertisement_st.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</guid>
	<pubDate>Fri, 28 Sep 2018 09:35:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</link>
	<title><![CDATA[GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences]]></title>
	<description><![CDATA[<p>GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:</p>
<ul>
<li>Step 1. Run mugsy to get multiple sequence alignment results.</li>
<li>Step 2 &amp; 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.</li>
<li>Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.</li>
<li></li>
<li></li>
</ul>
<p>https://github.com/DanwangJessica/GRSR</p><p>Address of the bookmark: <a href="https://github.com/DanwangJessica/GRSR" rel="nofollow">https://github.com/DanwangJessica/GRSR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/14011/dynamic-chromosome-breakpoints</guid>
	<pubDate>Wed, 13 Aug 2014 18:38:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/14011/dynamic-chromosome-breakpoints</link>
	<title><![CDATA[Dynamic chromosome breakpoints !!!]]></title>
	<description><![CDATA[<p>Cell division involves the distribution of identical genetic material, DNA, to two daughters&rsquo; cells. During this process, duplicated deoxyribonucleic acid (DNA) goes through a condensation and decondensation process. This is followed by nuclear envelope dissolution, mitotic spindle assembly, migration of the sister chromatid pairs to the metaphase plate, division and segregation of identical sets of chromosomes into daughter nuclei and nuclear envelope reformation.</p><p>The vital metaphase stage of cell division, when the sister chromatids migrated to the centre and lined up in a row, and pulled apart using attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chromosomes are free to undergo <strong>recombination </strong>which involves the exchange of genetic material either between multiple chromosomes or between different regions of the same chromosome.</p><p><img src="http://www.sciencelearn.org.nz/var/sciencelearn/storage/images/contexts/uniquely-me/sci-media/images/chromosomes-crossing-over/464438-1-eng-NZ/Chromosomes-crossing-over.jpg" alt="image" width="504" height="342" style="border: 0px; border: 0px;"></p><p>During recombination, the precise breakage of each strand, exchange between the strands, and sealing of the resulting recombined molecules happens. The &ldquo;<strong>chromosomal breakpoints</strong>&rdquo; refers to these places where they break. Mostly, this process occurs with a high degree of accuracy at high frequency in both eukaryotic and prokaryotic cells. But occasionally this &ldquo;break and sealing/ break and reattach&rdquo; process goes wrong and the reattachment happens in the wrong place which usually create disaster (with few exceptions).These chromosome disaster or abnormalities involve the gain, loss or rearrangement of visible amounts of genetic material during cell division. These abnormalities are of two type, the first one is numerical abnormalities &nbsp;where severe disorders are caused by the loss or gain of whole chromosomes, which affect the copy number of hundreds or even thousands of genes. The second are structural abnormalities which can be unbalanced or balanced. The former are similar to numerical abnormalities in that genetic material is either gained or lost. The natural defects in chromosome segregation are linked to cancer and several genetic diseases (http://en.wikipedia.org/wiki/List_of_genetic_disorders). Therefore, the enzymes involved in regulating cell division are still the attractive drug targets for many diseases.</p><p>&nbsp;</p><p>&nbsp;</p><p><img src="http://upload.wikimedia.org/wikipedia/commons/4/4a/Chromosomal_translocations.svg" alt="image" width="424" height="331" style="border: 0px; border: 0px;"></p><p>&nbsp;</p><p>Apart from certain chromosome abnormalities, these &ldquo;crossing over&rdquo; of segments of maternal and paternal chromosomes to form hybrid chromosomes have some evolutionary importance and considered as a driver of genetic variation. Moreover, the chromosome breakage in evolution is considered to be non-random in nature(http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0020014). In addition the study of breakpoint regions and non-breakpoint (stable) regions of chromosomes indicates both the regions evolved in distinctly different ways ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675965/). These breakage may lead to genetic diseases or participate to chromosomal rearranmgnets and contributed in development of new species.</p><p>I will try to explain the genome hotspots/Evolutionary Breakpoint Regions(EBRs)/fragile regions/weak fragments/&nbsp; in my next blog.</p><p><strong>Software for recombination detection:</strong></p><p><strong>RAT</strong> http://cbr.jic.ac.uk/dicks/software/RAT/</p><p><strong>Breakpointer</strong> https://github.com/ruping/Breakpointer</p><p><strong>DRP</strong> http://web.cbio.uct.ac.za/~darren/rdp.html</p><p><strong>RB-finder</strong> http://www.ncbi.nlm.nih.gov/pubmed/18707535</p><p><strong>LDhat2.0</strong> http://ldhat.sourceforge.net/LDhat2.0/instructions.shtml</p><p><strong>Reference:</strong></p><p>http://www.nature.com/scitable/topicpage/genetic-recombination-514#</p><p>Image: Wikipedia , sciencelearn.org.nz</p><p><strong>Recommended Articles:</strong></p><p>http://www.friendshipcircle.org/blog/2012/05/22/13-chromosomal-disorders-youve-never-heard-of/</p><p>http://web.udl.es/usuaris/e4650869/docencia/segoncicle/genclin98/recursos_classe_%28pdf%29/revisionsPDF/chromosyndromes.pdf</p><p>http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2775595/table/T2/</p><p>http://learn.genetics.utah.edu/content/disorders/chromosomal/</p><p>http://www.ncert.nic.in/html/learning_basket/biology/cc&amp;cd.pdf</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

</channel>
</rss>