<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/1182?offset=60</link>
	<atom:link href="https://bioinformaticsonline.com/related/1182?offset=60" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33586/genetic-mapper-svg-genetic-map-drawer</guid>
	<pubDate>Sun, 18 Jun 2017 14:11:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33586/genetic-mapper-svg-genetic-map-drawer</link>
	<title><![CDATA[Genetic-mapper: SVG Genetic Map Drawer]]></title>
	<description><![CDATA[<p><span>Genetic-mapper is a perl script able to draw publication-ready vectorial genetic maps.</span></p>
<p>Perl script for creating a publication-ready vectorial genetic/linkage map in Scalable Vector Graphics (SVG) format. The resulting file can either be submitted for publication and edited with any vectorial drawing software like&nbsp;<a href="https://inkscape.org/">Inkscape</a>&nbsp;and&nbsp;<a href="http://www.adobe.com/uk/products/illustrator.html">Abobe Illustrator(R)</a>.</p>
<p>The input file must be a text file with at least the marker name (ID), linkage group (LG) and the position (POS) separeted by tabulations. Additionally a logarithm of odds (LOD score) can be provided. Any extra parameter will be ignored.</p>
<pre><code>map.tsv

ID&lt;tab&gt;LG&lt;tab&gt;POS&lt;tab&gt;LOD
13519  12     0       0.250840894
2718   12     1.0     0.250840893
11040  12     1.6     0.252843341
...</code></pre>
<p>https://github.com/pseudogene/genetic-mapper</p><p>Address of the bookmark: <a href="https://github.com/pseudogene/genetic-mapper" rel="nofollow">https://github.com/pseudogene/genetic-mapper</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</guid>
	<pubDate>Tue, 26 Dec 2017 18:14:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</link>
	<title><![CDATA[Bioinformatics Web Application Development with Perl]]></title>
	<description><![CDATA[<div><p>Perl's second wave of adoption came from the growth of the world wide web. Dynamic web pages&mdash;the precursor to modern web applications&mdash;were easy to create with Perl and CGI. Thanks to Perl's ubiquity as a language for system administrators and its power to manipulate text, it was the default choice for web programming. Its presence everywhere made it popular and, in some ways, the duct tape of the Internet.</p><h4>Web Application Development</h4><p>The old days of CGI programs and the simple development style that represented seem clunky. Web pages have become web applications. Development has moved from generating static HTML to both client and server side programming, with rich client interfaces and powerful backends.</p><p>Perl is still well suited for developing modern web apps. The language grows more powerful and easier to use every year, the available libraries are wonderful and keep getting better, and the inventions and discoveries available in modern Perl are unsurpassed.</p><p>In particular, a modern Perl developer can do amazing things with modern Perl tools. If you still think of Perl web development as a&nbsp;<em>cgi-bin</em>&nbsp;directory full of messy scripts that spew warnings to STDERR, you're a decade out of date. Better yet, you can replace that mess piecemeal, thanks to the new tools and techniques of modern Perl. See, for example, the ever-growing list of technologies&nbsp;<a href="http://www.builtinperl.com/">Built in Perl</a>.</p><h4>Modern Perl Web Frameworks</h4><p>While the old wave of web development may have made the CGI.pm module central, modern Perl web programming follows a stricter separation of business logic, URL and request routing, and output. The days of slinging a string here, an array there, a Perl hash yonder, declaring every variable at the top of the program, and maybe making a subroutine are gone. The Perl world has seen the value of abstraction and ways to mechanize away boilerplate. Perl has dozens of frameworks and toolkits designed to make web development and deployment simpler.</p><p>Any of a dozen of these frameworks will help you do great things, but three in particular stand out. You can build web sites and web applications of tremendous value with all three. These are neither the only good possibilities (think of POE or Jifty or Continuity or...) nor the only mechanisms for web programming with Perl (see Mechanize or LWP or Mojo::UserAgent for more). Yet if you want three good options to choose between, start here.</p><h4>Catalyst</h4><p>The&nbsp;<a href="http://catalystframework.org/">Catalyst</a>&nbsp;framework is a flexible and powerful system for building small to large web apps. It uses the&nbsp;<a href="http://moose.perl.org/">Moose</a>&nbsp;object system to provide great APIs for extension and further development. It's the most mature of the modern top Perl web frameworks, yet it retains its flexibility and vibrancy. In particular, its plugin and extension ecosystem allows it to evolve to provide new and essential features.</p><p>Catalyst has embraced the Plack/PSGI standard for Perl web deployment and recent versions are exploring high-scalability, event-based request handling models.</p><h4>Dancer</h4><p>The&nbsp;<a href="http://perldancer.org/">Dancer</a>&nbsp;framework is deliberately minimal in syntax and scope, but it also has a vibrant plugin ecosystem. Dancer particularly excels for smaller sites and applications, though good programmers can build larger things with it.</p><p>The first version of Dancer was easy to use. Dancer 2 continues that ease while improving the internals and robustness of applications.</p><h4>Mojolicious</h4><p>The&nbsp;<a href="http://mojolicio.us/">Mojolicious</a>&nbsp;(Mojo) framework has a real-time design based on high performance event handling. Its focus is solving new and interesting problems in simple and effective ways, and the project has produced a lot of new code that does old things in better ways.</p><p>In particular, Mojolicious goes to great lengths to support new web standards, such as CSS 3, web sockets, and HTTP 2.</p><p>Where Catalyst embraces the CPAN fully, Mojolicious by design provides most of what an average app might need in a single download. It's still fully compatible with the CPAN, but the intention is to provide good working defaults in a package that's easy to start with. Mojo's fans are quick to praise it as fun to develop.</p><p>A modern Perl web developer should be familiar with at least one of these frameworks.</p><h4>Modern Perl Storage Mechanisms</h4><p>Perl's venerable&nbsp;<a href="http://search.cpan.org/perldoc?DBI">DBI</a>&nbsp;module has been the focal point of database access since its invention. Its design allows it to provide the same interface to huge relational databases and flat files alike through its DBD extension mechanism. Yet the DBI by itself isn't the be-all, end-all of data storage and access in Perl.</p><h4>DBIx::Class</h4><p><a href="http://search.cpan.org/perldoc?DBIx::Class">DBIx::Class</a>&nbsp;sits on top of DBI to provide an API to your database based on the concept of queries and results. This is often sufficient to remove all but the most complicated of SQL from your code, leaving you to manipulate your business models instead of the small details of how a relational database works. The power and maintainability you receive is well the small cost of the learning curve.</p><p>Even better, DBIC can manage (and even generate) your database schema for you.</p><p>Recent versions of DBIC have demonstrated that a well-written ORM can perform much better than even clever hand-written code. Because it builds on the Perl DBI, it scales everywhere from SQLite to PostgreSQL, MySQL, Oracle, and more.</p><h3>Rose::DB</h3><p>The lesser-known but no less powerful&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB::Object">Rose::DB::Object</a>&nbsp;builds on&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB">Rose::DB</a>&nbsp;to provide an object-relational mapper for Perl. While its high level features most directly compare to those of DBIx::Class, it's often measurably faster.</p><h4>NoSQL on the CPAN</h4><p>Of course the&nbsp;<a href="http://search.cpan.org/">CPAN</a>&nbsp;has modules for almost any NoSQL database or job queue or persistence mechanism you could name, and several you have never heard of. Everything you need is a quick CPAN or cpanm away!</p><h4>Modern Perl Deployment Strategies</h4><p>In the early days of the web, deploying a Perl web application meant putting one or more&nbsp;<em>.cgi</em>&nbsp;or&nbsp;<em>.pl</em>&nbsp;files in a special directory and hoping that your system administrator had everything configured correctly. The execution model was often slow and cumbersome, and accessing shared resources such as databases was often tricky.</p><p>Modern Perl has better choices. While deployment strategies are the source of many arguments, the return on your investment from learning the modern way is impressive.</p><h4>Plack/PSGI</h4><p>The PSGI specification (as exemplified by&nbsp;<a href="http://plackperl.org/">Plack</a>) describes a strategy for building Perl web apps independent of server and with the possibility to share custom processing behaviors.</p><p>In other words, it's a standard for writing Perl apps to take advantage of the huge ecosystem of Perl development available on the CPAN without tying yourself to a server like Apache, Apache 2, nginx, or anything else.</p><p>Any good modern Perl web framework (including those listed here) supports PSGI. Several deployment mechanisms exist to meet various business needs which also support PSGI. In particular, you can deploy the same application with a local testing server on your own machine as you can to your production server or servers without changing your application at all.</p><h4>mod_perl</h4><p>The older but still viable mod_perl Apache httpd module embeds Perl into the web server. This was the first widespread persistence mechanism for Perl web applications themselves and it's still popular to this day, though PSGI compliance is often the choice for new development. (PSGI handlers to use mod_perl as the backend are available.)</p><p>Modern Perl developers should familiarize themselves with PSGI and the wealth of available Plack middleware.</p><h4>Perl Web Development</h4><p>Of course no discussion of Perl web development would be complete without mentioning the strength of the CPAN. Almost any project will benefit from the wealth of freely available libraries built to solve real problems. These distributions run the gamut from full-blown web frameworks and content management systems to APIs for web services, development tools, testing systems, and interfaces to document formats and external resources.</p><p>For example, if you need to write a web service which accepts JSON data and produces Excel spreadsheets, you can glue together a few CPAN distributions and get the job done early. If you need to consume XML from a remote service and emit a PDF, you're in luck.</p><p>Perl's prowess as a general purpose programming language as well as its flexibility and power in managing text and gluing systems together make it a wonderful fit for web development. The community's adoption of modern Perl standards such as PSGI and Plack only enhance your power.</p><p>Web application development in Perl is still viable, and modern Perl tools and techniques and libraries make it more powerful and pleasant than ever.</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36927/restrictiondigest-a-powerful-perl-module-for-simulating-genomic-restriction-digests</guid>
	<pubDate>Tue, 12 Jun 2018 13:17:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36927/restrictiondigest-a-powerful-perl-module-for-simulating-genomic-restriction-digests</link>
	<title><![CDATA[RestrictionDigest: A powerful Perl module for simulating genomic restriction digests]]></title>
	<description><![CDATA[RestrictionDigest can simulate the reference genome digestion and generate comprehensive information of the simulation. It can simulate single-enzyme digestion, double-enzyme digestion and size selection process. It can also analyze multiple genomes at one run and generates concise comparison of enzyme(s) performance across the genomes.

For more information, please see the academic paper published online (http://www.sciencedirect.com/science/article/pii/S071734581630001X).<p>Address of the bookmark: <a href="https://github.com/JINPENG-WANG/RestrictionDigest" rel="nofollow">https://github.com/JINPENG-WANG/RestrictionDigest</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37592/benchmarking-perl-module</guid>
	<pubDate>Sat, 25 Aug 2018 11:40:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37592/benchmarking-perl-module</link>
	<title><![CDATA[Benchmarking Perl Module !]]></title>
	<description><![CDATA[<p>The benchmark module is a great tool to know the time the code takes to run. The output is usually in terms of CPU time. This module provides us with a way to optimize our code. With the advent of petascale computing and other multicore processor it is becoming a neccesity to know about the CPU time taken by our perl program.</p><p>This is the simple way to use the module</p><blockquote><p>Example1:</p><p>use Benchmark;</p><p>$first_time = Benchmark-&gt;new;</p><p>our code&hellip;&hellip;</p><p>$second_time = Benchmark-&gt;new;</p><p>$final_difference = timediff($first_time,$second_time);</p><p>print &ldquo;the code took, timestr($final_difference),&rdquo;\n&rdquo;;</p></blockquote><p>that was a very simple way to know the time diff , we can use it to know the time taken by some part of the code in the program.</p><blockquote><p>More sophisticated way:</p><p>use Benchmark;<br />sub first {</p><p>my(arguments) = @_;</p><p>}</p><p>timethese(100, { first =&gt; &lsquo;first_sub(arguments)&rsquo;});</p><p>The first argument to timethese is 100 (evaluate 100 times).</p></blockquote><p>Hope this very small tutorial with Benchmark will help people get started.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>