<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14011?offset=1430</link>
	<atom:link href="https://bioinformaticsonline.com/related/14011?offset=1430" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17926/orange-bioinformatics-2534</guid>
	<pubDate>Mon, 06 Oct 2014 12:51:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17926/orange-bioinformatics-2534</link>
	<title><![CDATA[Orange-Bioinformatics 2.5.34]]></title>
	<description><![CDATA[<p>Orange Bioinformatics extends <a href="http://orange.biolab.si/">Orange</a>, a data mining software package, with common functionality for bioinformatics. The provided functionality can be accessed as a Python library or through a visual programming interface (Orange Canvas). The latter is also suitable for non-programmers.</p>
<p>Orange Bioinformatics provides access to publicly available data, like GEO data sets, Biomart, GO, KEGG, Atlas, ArrayExpress, and PIPAx database. As for the analytics, there is gene selection, quality control, scoring distances between experiments with multiple factors. All features can be combined with powerful visualization, network exploration and data mining techniques from the Orange data mining framework.</p><p>Address of the bookmark: <a href="https://pypi.python.org/pypi/Orange-Bioinformatics/2.5.34" rel="nofollow">https://pypi.python.org/pypi/Orange-Bioinformatics/2.5.34</a></p>]]></description>
	<dc:creator>Robert M Willioms</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/18380/jrfsrf-at-university-of-hyderabad</guid>
  <pubDate>Fri, 17 Oct 2014 01:55:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF/SRF at University of Hyderabad]]></title>
  <description><![CDATA[
<p>Applications are invited for the following post of Junior Research Fellow (temporary position coterminous with the project) under DBT funded research project on ““Understanding the functions of α1β1γ1/α2β1γ1 selective AMPK Modulators in dissecting the pharmacological role of these isozymes in metabolic diseases”</p>

<p>Qualified and interested candidates can send their curriculum vitae by e-mail to hr@drils.org on or before 27th October 2014 mention in the subject line of the mail the following code: AMPK-Biology.</p>

<p>Selected candidates will be called for a personal interview to Dr. Reddy’s Institute of Life Sciences, University of Hyderabad Campus, Gachibowli, Hyderabad. The selected candidate is expected to report within two weeks from the date of selection to start work on the project.</p>

<p>Junior Research Fellowship (Molecular Modeling/Biology) for two years and Senior Research fellowship for one year</p>

<p>Junior Research Fellowship: Rs. 15,600/- (consolidated) per month for first two years.<br />Senior Research Fellowship: Rs. 18,200/-(consolidated) per month for the 3rd year.</p>

<p>Duration: The duration of the fellowship is for three years. However, the performance of the candidate will be reviewed after the completion of every year and the fellowship will be renewed only upon satisfactory performance.</p>

<p>Responsibilities:</p>

<p>1) Literature search.<br />2) Design, plan and execute experiments under the supervision of the scientist.<br />3) Provide scientific support to the scientist in his/her research activities.<br />4) Book keeping and maintenance of stocks and consumables.</p>

<p>Essential Qualifications:</p>

<p>Required: M.Sc. in Microbiology/Biotechnology/Bioinformatics or any other related branch of basic Sciences from a recognized university/institute with a consistent academic record of minimum 60% aggregate in all qualifying examinations. The candidate should be NET qualified for lectureship. The candidate should be motivated to work with dedication.</p>

<p>Desirable: expertise/experience in both Molecular Modeling and Molecular Biology.</p>

<p>Experience: 0-2 years in the areas of Molecular Modeling and/or Molecular Biology and cell biology and Biochemistry.</p>

<p>Preferable: Relevant research experience as evident from thesis/dissertation/project work.</p>

<p>Advertisement: http://www.ilsresearch.org/userfiles/Junior%20REsearch%20Fellowship%20-%20AMPK(Biology).pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/18385/biinformamatics-lead-at-google-life-sciences</guid>
  <pubDate>Fri, 17 Oct 2014 02:24:55 -0500</pubDate>
  <link></link>
  <title><![CDATA[Biinformamatics Lead at Google Life Sciences]]></title>
  <description><![CDATA[
<p>Google Life Sciences is recruiting a technical lead with experience in bioinformatics and clinical bioinformatics, including for biomarker discovery projects such as the Baseline study.</p>

<p>Responsibilities</p>

<p>Lead teams of scientists in structuring, prototyping, and executing large-scale bioinformatic and other analysis.<br />Develop novel bioinformatics, statistical, data processing, pathway, data mining and other algorithms to identify biological signals and their clinical correlates in broad kinds of individual and population data.<br />Develop novel platform-level analytical tools for sequence-based assays (assembly, annotation, variant calling and interpretation, phasing, genome structure, etc.), expression assays (RNAseq and microarray), proteomics, and metabolomics.<br />Develop statistical models that robustly correlate complex laboratory-derived information with phenotypic and clinical information.<br />Create scientifically rigorous visualizations, communications, and presentations of results.</p>

<p>Reference @ https://www.google.com/about/careers/search#!t=jo&amp;jid=62095001</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/18580/faculty-positions-at-central-university-of-punjab-bathinda</guid>
  <pubDate>Wed, 22 Oct 2014 10:45:37 -0500</pubDate>
  <link></link>
  <title><![CDATA[Faculty Positions at CENTRAL UNIVERSITY OF PUNJAB, BATHINDA]]></title>
  <description><![CDATA[
<p>Advertisement No. T/NT-01 (2014)</p>

<p>Faculty Positions<br />The Central University of Punjab (CUP), Bathinda will be having the Schools and Departments as given in Table-I. The University invites applications from eligible candidates for the posts of Professors (Pay Band Rs. 37400-67000 with AGP of Rs. 10, 000/-), Associate Professors (Pay Band Rs.37400-67000 with AGP of Rs. 9,000/-) and Assistant Professors (Pay Band Rs.15600-39100 with AGP of Rs. 6,000/-)</p>

<p>POSITION AVAILABLE IN THE AREA OF SPECIALIZTION</p>

<p>3. Bioinformatics,</p>

<p>Procedure to apply: Application forms along with API form complete in all respect along with necessary documents and application fee of Rs. 750/-. (Rs. 250/- for Scheduled Caste/Scheduled Tribe/Person with disabilities) should be sent to:</p>

<p>Registrar (Officiating)<br />Central University of Punjab<br />City Campus, Mansa Road<br />Bathinda-151 001</p>

<p>Application forms from the prospective candidates are accepted upto November 10, 2014.</p>

<p>Based on the qualification of the candidates and the need of the university, the applications received will be processed through appropriately constituted selection committees shortly. Minimum qualification can be relaxed in case of exceptionally outstanding candidate. For further details visit www.cup.ac.in; www.centralunipunjab.com; www.cup.edu.in</p>

<p>The candidate should download the application form available at website www.cup.ac.in;<br />www.centralunipunjab.com; and submit it complete in all respects on or before 10th November 2014.</p>

<p>Those who have applied earlier need to submit Academic Performance Index (API) form, 5 copies of Summary of the Application Form (available at: www.cup.ac.in; www.centralunipunjab.com and Updated CV if not updated recently (without application fee).</p>

<p>http://cup.edu.in/Faculty_details_and_general_instructions.pdf</p>

<p>http://cup.edu.in/Final%20Application%20and%20summary%20Sheet%20and%20Api%20form.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/19020/jrf-in-bioinformatics-bioinformatics-centre-north-eastern-hill-university</guid>
  <pubDate>Thu, 06 Nov 2014 10:24:05 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF in Bioinformatics @ Bioinformatics Centre, North-Eastern Hill University]]></title>
  <description><![CDATA[
<p>Applications with complete bio-data are invited for JRF (3) and Project Assistant (1) in a DBT project "Next Generation Sequencing (NGS)-based de novo assembly of expressed transcripts and genome information of Orchids in North-East India" sanctioned for a period of 3 years.</p>

<p>Details are available at www.nehu.ac.in and www.bicnehu.ac.in.</p>

<p>Applications must reach the undersigned within 15 days from the date of publication of this advertisement.</p>

<p>Prof. Pramod Tandon. PI/Mr. Devendra Kumar Biswal (Co-PI)</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/19087/dcgor</guid>
	<pubDate>Sat, 08 Nov 2014 14:54:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/19087/dcgor</link>
	<title><![CDATA[dcGOR]]></title>
	<description><![CDATA[<p>An R package for analysing ontologies and protein domain annotations has been published in PLoS Computational Biology (http://dx.doi.org/10.1371/journal.pcbi.1003929). The package is distributed as part of CRAN (http://cran.r-project.org/package=dcGOR), and also at GitHub for version control.<br /><br />The dedicated website is available in http://supfam.org/dcGOR, from which several demos are also provided:<br /><br />1. Analysing SCOP domains: http://supfam.org/dcGOR/demo-Fang.html<br /><br />2. Analysing Pfam domains: http://supfam.org/dcGOR/demo-Basu.html<br /><br />3. Analysing InterPro domains: http://supfam.org/dcGOR/demo-Customisation.html<br /><br />&nbsp;</p>]]></description>
	<dc:creator>Martin Jones</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>