BOL: Related items

Research Fellows at AIMSCS, Hyderabad

Wed, 06 May 2015 06:23:33 -0500

C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh
Advertisement No.: 5/2015

Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)

JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,

Pay Scale : Rs. 25,000

SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.

Pay Scale : Rs. 28,000*

No.of Post: 2

Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.

More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf

Roary: the Pan Genome Pipeline

Jit — Tue, 22 Jan 2019 05:52:07 -0600

Roary is a high speed stand alone pan genome pipeline, which takes annotated assemblies in GFF3 format (produced by Prokka (Seemann, 2014)) and calculates the pan genome. Using a standard desktop PC, it can analyse datasets with thousands of samples, something which is computationally infeasible with existing methods, without compromising the quality of the results. 128 samples can be analysed in under 1 hour using 1 GB of RAM and a single processor. To perform this analysis using existing methods would take weeks and hundreds of GB of RAM. Roary is not intended for meta-genomics or for comparing extremely diverse sets of genomes.

Address of the bookmark: https://sanger-pathogens.github.io/Roary/

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

RaGOO: Fast Reference-Guided Scaffolding of Genome Assembly Contigs

BioJoker — Wed, 17 Apr 2019 19:45:22 -0500

Alonge M, Soyk S, Ramakrishnan S, Wang X, Goodwin S, Sedlazeck FJ, Lippman ZB, Schatz MC: Fast and accurate reference-guided scaffolding of draft genomes. bioRxiv 2019.

RaGOO is a tool for coalescing genome assembly contigs into pseudochromosomes via minimap2 alignments to a closely related reference genome. The focus of this tool is on practicality and therefore has the following features:

Good performance. On a MacBook Pro using Arabidopsis data, pseudochromosome construction takes less than a minute and the whole pipeline with SV calling takes ~2 minutes.
Intact ordering and orienting of contigs.
Chimeric contig correction
GFF lift-over
Structural variant calling with and integrated version of Assemblytics
Confidence scores associated with the grouping, localization, and orientation for each contig.

Address of the bookmark: https://github.com/malonge/RaGOO

MGSE: Mapping-based Genome Size Estimation

Shruti Paniwala — Fri, 17 Jan 2020 02:11:43 -0600

MGSE can harness the power of files generated in genome sequencing projects to predict the genome size. Required are the FASTA file containing a high continuity assembly and a BAM file with all available reads mapped to this assembly. The script construct_cov_file.py (https://doi.org/10.1186/s12864-018-5360-z) allows the generation of a COV file based on the (sorted) BAM file (also possible via MGSE directly). Next, this COV file can be used by MGSE to calculate the coverage in provided reference regions and to calculate the total number of mapped bases. Both values are subjected to the genome size estimation. Providing accurate reference regions is crucial for this genome size estimation.

Address of the bookmark: https://github.com/bpucker/MGSE

Rosenberg lab

Wed, 27 May 2015 17:52:24 -0500

Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

U-Plot: Genome U-Plot sample implementation

Rahul Nayak — Tue, 03 Mar 2020 01:39:12 -0600

The Genome U-Plot is a JavaScript tool to visualize Chromosomal abnormalities in the Human Genome using a U-shape layout.

Address of the bookmark: https://github.com/gaitat/GenomeUPlot

JRF Bioinformatics @ ICAR - National Research Centre for Orchids Pakyong

Thu, 28 May 2015 19:33:19 -0500

ICAR - National Research Centre for Orchids

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Genome assembly training tutorial at Galaxy !

Jit — Sun, 27 Dec 2020 05:25:45 -0600

In this tutorial we assemble and annotate the genome of E. coli strain C-1. This strain is routinely used in experimental evolution studies involving bacteriophages. For instance, now classic works by Holly Wichman and Jim Bull (Bull 1997, Bull 1998, Wichman 1999) have been performed using this strain and bacteriophage phiX174.

Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}