• Store alignments and variant calls for one genome or a million.
• Process genomic data in batch by running principal component analysis or Hardy-Weinberg equilibrium, in minutes or hours, by using parallel computing frameworks like MapReduce.
• Explore data by slicing alignments and variants by genomic range across one or multiple samples -- for your own algorithms or for visualization; or interactively process entire cohorts to find transition/transversion ratios, allelic frequency, genome-wide association and more using BigQuery.
• Share genomic data with your research group, collaborators, the broader community, or the public. You decide.

Google Genomics is implementing the API defined by the Global Alliance for Genomics and Health for visualization, analysis and more. Compliant software can access Google Genomics, local servers, or any other implementation.

Address of the bookmark: https://cloud.google.com/genomics/

01. Scientist II 01
Essential: Ph.D. degree in Life Sciences from a recognized university along with a minimum of 2 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

OR
Ph.D. degree in Bioinformatics from a recognized university.

OR
M.Sc. in Bioinformatics from a recognized university along with a minimum of 3 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

Desirable:
Thorough Knowledge about In silico genome analysis and comparative genomics.
Experience with in silico identification of novel virulence factors of pathogens, host-pathogen interactions and Systems Biology.
Additional Postdoctoral research experience in relevant subjects from a recognized institutions.

Rs. 44,000/- p.m. (consolidated) plus 30% HRA

Below 40 years

Applications along with Bio-Data containing detail work experience and full list of publications may be sent via email tosantasabujdas@yahoo.com latest by October 27, 2014.

Short-listed candidates will be called via email for an interview to be held at the institute in the second week of November, 2014.

Advertisement: www.niced.org.in/placements.htm

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Good communication skills and fluency in spoken and written English are required.
Please apply sending a curriculum vitae, the names of at least two referees and a letter of motivation describing past experience and future goals to anna.tramontano@uniroma1.it with subject: “Application for post-doctoral position November 2014 YOUR LAST NAME”

Deadline: No later than November 28th, 2014.
Duration: 2 years

Salary on grant: Commeasured to the experience of the candidate
Contact Person (Referent): Anna Tramontano
Ref. E-Mail: anna.tramontano@uniroma1.it
Group Web Page: http:/www.biocomputing.it

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net

Essential Qualification
For Research Fellow:-
M.Sc. in Systems Biology and Bioinformatics / Life
Sciences with minimum 55% marks.
Preference will be given to NET/GATE/ICMR qualified candidates without fellowship however, candidates who have cleared the Panjab University Ph.D. entrance test in Systems Biology & Bioinformatics will also be eligible.

Applications should be reach on or before 19-11-2014 in the office of the undersigned. Interview will be held on 21-11-2014 in the office of the Coordinator, Centre for Systems Biology & Bioinformatics, South Campus, Block-3, Sector-25, Panjab University, Chandigarh. No TA/DA will be paid.

more at http://jobs.puchd.ac.in/includes/jobs/2014/20141110143634-Advertisement.pdf

Candidates having the below mentioned qualifications may appear for walk in interview at ICPO on 2nd December 2014 between 10.00 AM and 12:00 PM under the below time bound projects under Dr. Subhash M. Agarwal, Scientist C. The post is purely temporary and co-terminus with the project.

Research Assistant (One)
25650/- consolidated
Discovery of EGFR secondary mutant inhibitors using structure based screening approach (ICMR)
Duration: 7 months

Essential: M.Sc./ M.Tech in Bioinformatics or any other related subject with good academic record.

Desirable: Experience in scripting and molecular docking.

Below 30 years

Junior Research Fellow (One)

16,000 + 30% HRA = Rs. 20800/-

Identification of novel inhibitors targeting EGFR using an integrated ligand and structure based approach (DBT)

Duration: 9 months

Essential: M.Sc./ M.Tech in Bioinformatics or any other related subject with good academic record. Candidates with CSIR-UGC / ICMR, NET qualification will be preferred

Desirable: Experience in scripting, QSAR and molecular docking.

Below 28 years

Interested eligible candidates may send their applications with Bio-data by email at (smagarwal@gmail.com) or by post addressed to Dr. Subhash M Agarwal, Scientist C, Institute of Cytology and Preventive Oncology (ICPO) I-7, Sector-39, Noida-201301 so as to reach latest by 1st December, 2014. The candidates may appear for interview at ICPO along with 3 copies of CV, photo and relevant certificates of qualifications in original and reprints of publications at the time of interview. It should be noted that No TA/DA will be paid for the walk in Interview.

Advertisement: www.icpo.org.in/advt-walk-in-interview.docx

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py