BOL: Related items

BEAP: Blast Extension and Assembly Program

Shruti Paniwala — Mon, 11 Jun 2018 04:52:56 -0500

The Blast Extension and Assembly Program (BEAP) is a computer program that uses a short starting DNA fragment, often a EST or partial gene segment, as "primer", to recursively blast nucleotide databases in an attempt to obtain all sequences that overlaps, directly or indirectly, with the "primer" therefore help to "extend" the length of the original sequence for constructing a "full length" sequence for functional analysis, or at least to obtain neighboring regions of the segment for SNP discovery and linkage disequilibrium analysis. The confidence of assembling the resulting sequences is achieved by using a known genome, such as human genome, as a reference. https://www.animalgenome.org/tools/beap/

Address of the bookmark: https://www.animalgenome.org/tools/beap/

Charpak exchange program

Fri, 10 Nov 2023 02:33:38 -0600

The scholarship is designed for Indian students from all fields and streams of study, enrolled in an Indian institution at the Bachelors or Master’s degree level, who wish to undertake a study exchange semester programme in France (for a period of one to six months).

BENEFITS
The Charpak exchange program offers the following benefits to the awardees based on merit: monthly stipend of 860 euros social security student visa and Campus France fee waiver assistance in finding an affordable student accommodation (subject to availability)

https://www.inde.campusfrance.org/charpak-exchange-scholarship-spring-session-jan-june

HISAT2: a fast and sensitive alignment program for mapping next-generation sequencing reads

Rahul Nayak — Tue, 08 May 2018 04:27:22 -0500

HISAT2 is a fast and sensitive alignment program for mapping next-generation sequencing reads (both DNA and RNA) to a population of human genomes (as well as to a single reference genome). Based on an extension of BWT for graphs [Sirén et al. 2014], we designed and implemented a graph FM index (GFM), an original approach and its first implementation to the best of our knowledge. In addition to using one global GFM index that represents a population of human genomes, HISAT2 uses a large set of small GFM indexes that collectively cover the whole genome (each index representing a genomic region of 56 Kbp, with 55,000 indexes needed to cover the human population). These small indexes (called local indexes), combined with several alignment strategies, enable rapid and accurate alignment of sequencing reads. This new indexing scheme is called a Hierarchical Graph FM index (HGFM).

more at https://ccb.jhu.edu/software/hisat2/index.shtml

Address of the bookmark: https://github.com/infphilo/hisat2

PANDASEQ is a program to align Illumina reads, optionally with PCR primers embedded in the sequence, and reconstruct an overlapping sequence.

BioStar — Fri, 21 Sep 2018 10:19:52 -0500

Development packages for zlib and libbz2 are needed, as well as a standard compiler environment. On Ubuntu, this can be installed via:

sudo apt-get install build-essential libtool automake zlib1g-dev libbz2-dev pkg-config

On MacOS, the Apple Developer tools and Fink (or MacPorts or Brew) must be installed, then:

sudo fink install bzip2-dev pkgconfig

Address of the bookmark: https://github.com/neufeld/pandaseq

LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.

Neel — Sun, 13 Jan 2019 07:05:53 -0600

LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.

The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE, http://www.expasy.org/prosite/) to locate cores of important enzymes if they occur.

Address of the bookmark: https://github.com/xzhub/LTR_Finder

Gooey: Turn (almost) any Python command line program into a full GUI application with one line

BioStar — Fri, 01 Nov 2019 00:29:27 -0500

Turn (almost) any Python command line program into a full GUI application with one line

The easiest way to install Gooey is via pip

pip install Gooey

Alternatively, you can install Gooey by cloning the project to your local directory

git clone https://github.com/chriskiehl/Gooey.git

run setup.py

python setup.py install

Address of the bookmark: https://github.com/chriskiehl/Gooey

CrossMap: program for genome coordinates conversion between different assemblies

Rahul Nayak — Tue, 25 Jan 2022 17:59:32 -0600

CrossMap is a program for genome coordinates conversion between different assemblies (such as hg18 (NCBI36) <=> hg19 (GRCh37)). It supports commonly used file formats including BAM, CRAM, SAM, Wiggle, BigWig, BED, GFF, GTF, MAF VCF, and gVCF.

Address of the bookmark: http://crossmap.sourceforge.net/

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Advanced Bash-Scripting Guide

Jit — Thu, 18 Feb 2016 04:50:51 -0600

This tutorial assumes no previous knowledge of scripting or programming, yet progresses rapidly toward an intermediate/advanced level of instruction . . . all the while sneaking in little nuggets of UNIX® wisdom and lore. It serves as a textbook, a manual for self-study, and as a reference and source of knowledge on shell scripting techniques. The exercises and heavily-commented examples invite active reader participation, under the premise that the only way to really learn scripting is to write scripts.

This book is suitable for classroom use as a general introduction to programming concepts.

More at http://tldp.org/LDP/abs/html/

Address of the bookmark: http://tldp.org/LDP/abs/html/