<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14215?offset=1020</link>
	<atom:link href="https://bioinformaticsonline.com/related/14215?offset=1020" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43799/kast</guid>
	<pubDate>Wed, 23 Feb 2022 08:28:36 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43799/kast</link>
	<title><![CDATA[KAST]]></title>
	<description><![CDATA[<p><span>Perform Alignment-free k-tuple frequency comparisons from sequences. This can be in the form of two input files (e.g. a reference and a query) or a single file for pairwise comparisons to be made.</span></p><p>Address of the bookmark: <a href="https://github.com/martinjvickers/KAST" rel="nofollow">https://github.com/martinjvickers/KAST</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22403/ryan-e-mills-lab</guid>
  <pubDate>Tue, 26 May 2015 09:29:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ryan E. Mills Lab]]></title>
  <description><![CDATA[
<p>Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.</p>

<p>We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics. </p>

<p>More at http://millslab.ccmb.med.umich.edu/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44223/ale-assembly-likelihood-estimator</guid>
	<pubDate>Wed, 08 Mar 2023 01:39:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44223/ale-assembly-likelihood-estimator</link>
	<title><![CDATA[ALE: Assembly Likelihood Estimator]]></title>
	<description><![CDATA[<p>Just import the assembly, bam and ALE scores. You can convert the .ale file to a set of .wig files with ale2wiggle.py and IGV can read those directly.&nbsp; Depending on your genome size you may want to convert the .wig files to the BigWig format.</p><p>Address of the bookmark: <a href="https://github.com/sc932/ALE" rel="nofollow">https://github.com/sc932/ALE</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/44371/steps-to-find-all-the-repeats-in-the-genome</guid>
	<pubDate>Thu, 31 Aug 2023 02:43:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/44371/steps-to-find-all-the-repeats-in-the-genome</link>
	<title><![CDATA[Steps to find all the repeats in the genome !]]></title>
	<description><![CDATA[<div><p>To find repeats in a genome from 2 to 9 length using a Perl script, you can use the RepeatMasker tool with the "--length" option<a href="https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-13" target="_blank">[0]</a>. Here's a step-by-step guide:</p></div><div><ol>
<li>Install RepeatMasker: First, you need to install RepeatMasker on your system. You can download it from the RepeatMasker website<a href="https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-13" target="_blank">[0]</a>.</li>
</ol></div><div><ol>
<li>Prepare the genome sequence: Make sure you have the genome sequence in a FASTA file format. Let's assume the file is named "genome.fasta".</li>
</ol><blockquote><p>./RepeatMasker -pa &lt;number_of_processors&gt; -nolow -norna -no_is -div &lt;divergence_value&gt; -lib RepeatMaskerLib.embl -gff -xsmall -small -poly -species &lt;species_name&gt; -dir &lt;output_directory&gt; -length &lt;min_length&gt;-&lt;max_length&gt; genome.fasta</p></blockquote><div><p>Replace the following placeholders with appropriate values:</p><ul>
<li><code>&lt;number_of_processors&gt;</code>: The number of processors/threads you want to use for parallel processing.</li>
<li><code>&lt;divergence_value&gt;</code>: The divergence value for the species you are analyzing. You can find divergence values for different species in the RepeatMasker documentation<a href="https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-13" target="_blank">[0]</a>.</li>
<li><code>&lt;species_name&gt;</code>: The name of the species you are analyzing.</li>
<li><code>&lt;output_directory&gt;</code>: The directory where you want the output files to be saved.</li>
<li><code>&lt;min_length&gt;</code>&nbsp;and&nbsp;<code>&lt;max_length&gt;</code>: The minimum and maximum lengths of the repeats you want to find (in this case, 2 and 9).</li>
</ul></div><div><ol>
<li>Analyze the output: RepeatMasker will generate several output files, including a .out file. You can parse this file to extract the information you need. There is a Perl tool called "one_code_to_find_them_all.pl" that can help you parse RepeatMasker output files<a href="https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-13" target="_blank">[0]</a>. You can download it from the source provided.</li>
</ol></div><div><ol>
<li>Use the provided Perl script: Once you have the "one_code_to_find_them_all.pl" script, you can run it to conveniently parse the RepeatMasker output files. Here's an example of how to use it:</li>
</ol><blockquote><p>perl one_code_to_find_them_all.pl --rm &lt;RepeatMasker_out_file&gt; --length &lt;length_file&gt;</p></blockquote></div><p>&nbsp;</p></div><div><div><p>Replace&nbsp;<code>&lt;RepeatMasker_out_file&gt;</code>&nbsp;with the path to your RepeatMasker .out file, and&nbsp;<code>&lt;length_file&gt;</code>&nbsp;with the path to a file containing the lengths of the reference elements.</p></div><div><p>This script will generate several output files, including .log.txt and .copynumber.csv, which contain quantitative information about the identified repeat elements.</p></div><div><p>Remember to adjust the parameters and options according to your specific needs and the characteristics of your genome.</p></div></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44628/uncovar-workflow-for-transparent-and-robust-virus-variant-calling-genome-reconstruction-and-lineage-assignment</guid>
	<pubDate>Mon, 05 Aug 2024 23:01:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44628/uncovar-workflow-for-transparent-and-robust-virus-variant-calling-genome-reconstruction-and-lineage-assignment</link>
	<title><![CDATA[UnCoVar: Workflow for Transparent and Robust Virus Variant Calling, Genome Reconstruction and Lineage Assignment]]></title>
	<description><![CDATA[<p>UnCoVar: Workflow for Transparent and Robust Virus Variant Calling, Genome Reconstruction and Lineage Assignment</p>
<ul>
<li>
<p>Using state of the art tools, easily extended for other viruses</p>
</li>
<li>
<p>Tool and database updates for critical components via Conda</p>
</li>
<li>
<p>Built using modern design patterns with Conda and Snakemake</p>
</li>
<li>
<p>Extensible and easy to customize</p>
</li>
<li>
<p>Submission Ready Genomes</p>
</li>
<li>
<p>Customizable reporting with comprehensive visualization</p>
</li>
</ul>
<p>https://ikim-essen.github.io/uncovar/</p>
<p>Github&nbsp;https://github.com/IKIM-Essen/uncovar</p>
<p>&nbsp;</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://ikim-essen.github.io/uncovar/" rel="nofollow">https://ikim-essen.github.io/uncovar/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44775/genomic-architecture-surrounding-the-fusion-site-of-human-chromosome-2</guid>
	<pubDate>Tue, 04 Mar 2025 12:26:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44775/genomic-architecture-surrounding-the-fusion-site-of-human-chromosome-2</link>
	<title><![CDATA[Genomic architecture surrounding the fusion site of human chromosome 2]]></title>
	<description><![CDATA[<p>The article <strong>"Genomic Structure and Evolution of the Ancestral Chromosome Fusion Site in 2q13&ndash;2q14.1 and Paralogous Regions on Other Human Chromosomes (https://pmc.ncbi.nlm.nih.gov/articles/PMC187548/)"</strong> explores the genomic architecture surrounding the fusion site of human chromosome 2. This fusion event is a key evolutionary marker distinguishing humans from other great apes, as humans have 46 chromosomes while chimpanzees, gorillas, and orangutans possess 48. The fusion occurred through an end-to-end joining of two ancestral chromosomes, which remain separate in nonhuman primates.</p><h3><strong>Key Findings:</strong></h3><ol>
<li>
<p><strong>Chromosomal Fusion and Its Molecular Signature:</strong></p>
<ul>
<li>The fusion site is located at <strong>2q13&ndash;2q14.1</strong> and is characterized by <strong>degenerate telomeric sequences</strong> appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.</li>
<li>Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.</li>
</ul>
</li>
<li>
<p><strong>Extensive Duplications in the Surrounding Genomic Region:</strong></p>
<ul>
<li>The study identifies <strong>large-scale segmental duplications</strong> flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.</li>
<li>These duplications are predominantly located in <strong>subtelomeric and pericentromeric regions</strong>, suggesting their role in genomic instability and chromosomal evolution.</li>
</ul>
</li>
<li>
<p><strong>Paralogous Regions and Their Evolutionary Relationships:</strong></p>
<ul>
<li>A <strong>168-kilobase (kb) segment</strong> near the fusion site has <strong>98%&ndash;99% sequence identity</strong> with three regions on <strong>chromosome 9 (9pter, 9p11.2, and 9q13)</strong>.</li>
<li>Another <strong>67-kb region distal to the fusion site</strong> shows a high degree of homology to sequences in <strong>chromosome 22qter</strong>.</li>
<li>Additionally, a <strong>100-kb segment</strong> exhibits <strong>96% sequence identity</strong> with a region in <strong>chromosome 2q11.2</strong>.</li>
</ul>
</li>
<li>
<p><strong>Comparative Genomics and Evolutionary Implications:</strong></p>
<ul>
<li>By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.</li>
<li>The presence of specific repetitive elements within these duplicated segments serves as <strong>evolutionary markers</strong> that help infer their historical rearrangements.</li>
<li>Some of these <strong>duplicated regions are associated with chromosomal inversion breakpoints</strong>, potentially contributing to evolutionary changes in primates.</li>
<li>Recurrent <strong>structural rearrangements</strong> in these regions have been linked to human chromosomal disorders.</li>
</ul>
</li>
</ol><h3><strong>Conclusions and Implications:</strong></h3><ul>
<li>The findings provide valuable insights into <strong>the structural evolution of human chromosome 2</strong>, which played a crucial role in human speciation.</li>
<li>Understanding these <strong>segmental duplications</strong> and their evolutionary trajectories sheds light on <strong>genomic instability</strong>, which may contribute to <strong>human genetic diseases</strong>.</li>
<li>The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the <strong>evolutionary divergence of humans</strong> from other primates.</li>
</ul><p>This research advances our understanding of <strong>human genome evolution</strong> and offers a foundation for studying the effects of <strong>structural variants in genetic disorders</strong>.</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>