Address of the bookmark: https://github.com/martinjvickers/KAST

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Address of the bookmark: https://github.com/sc932/ALE

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

To find repeats in a genome from 2 to 9 length using a Perl script, you can use the RepeatMasker tool with the "--length" option[0]. Here's a step-by-step guide:

• Using state of the art tools, easily extended for other viruses

• Tool and database updates for critical components via Conda

• Built using modern design patterns with Conda and Snakemake

• Extensible and easy to customize

• Submission Ready Genomes

• Customizable reporting with comprehensive visualization

https://ikim-essen.github.io/uncovar/

Github https://github.com/IKIM-Essen/uncovar

Address of the bookmark: https://ikim-essen.github.io/uncovar/

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Key Findings:

1. Chromosomal Fusion and Its Molecular Signature:

   • The fusion site is located at 2q13–2q14.1 and is characterized by degenerate telomeric sequences appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.
   • Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.

2. Extensive Duplications in the Surrounding Genomic Region:

   • The study identifies large-scale segmental duplications flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.
   • These duplications are predominantly located in subtelomeric and pericentromeric regions, suggesting their role in genomic instability and chromosomal evolution.

3. Paralogous Regions and Their Evolutionary Relationships:

   • A 168-kilobase (kb) segment near the fusion site has 98%–99% sequence identity with three regions on chromosome 9 (9pter, 9p11.2, and 9q13).
   • Another 67-kb region distal to the fusion site shows a high degree of homology to sequences in chromosome 22qter.
   • Additionally, a 100-kb segment exhibits 96% sequence identity with a region in chromosome 2q11.2.

4. Comparative Genomics and Evolutionary Implications:

   • By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.
   • The presence of specific repetitive elements within these duplicated segments serves as evolutionary markers that help infer their historical rearrangements.
   • Some of these duplicated regions are associated with chromosomal inversion breakpoints, potentially contributing to evolutionary changes in primates.
   • Recurrent structural rearrangements in these regions have been linked to human chromosomal disorders.

Conclusions and Implications:

• The findings provide valuable insights into the structural evolution of human chromosome 2, which played a crucial role in human speciation.
• Understanding these segmental duplications and their evolutionary trajectories sheds light on genomic instability, which may contribute to human genetic diseases.
• The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the evolutionary divergence of humans from other primates.

This research advances our understanding of human genome evolution and offers a foundation for studying the effects of structural variants in genetic disorders.

“It’s like a subway map,” she said, “but for DNA.”

That idea is exactly what Sequence Tube Map brings to life.

Instead of showing a genome as one long, confusing sequence, it displays different genomic paths like routes on a metro map. Where sequences are shared, the paths travel together. Where genetic variation occurs, they branch into different routes and may join again later.

This makes complex genome graphs much easier to explore.

Maya could now see how different haplotypes moved through the same genomic region and where they took different paths. She could even view sequencing reads mapped onto the graph, helping her understand what was happening in regions with genetic variation.

What once looked like a tangled network now looked like a journey.

Sequence Tube Map turns the complexity of graph genomes into a visual story—making it easier for scientists to see how DNA can take different routes.

Read more at  https://github.com/vgteam/sequencetubemap 

and

https://academic.oup.com/bioinformatics/article/35/24/5318/5542397

Demo at https://vgteam.github.io/sequenceTubeMap/