<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14215?offset=1480</link>
	<atom:link href="https://bioinformaticsonline.com/related/14215?offset=1480" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17187/urdip-bioinformatics-rajrf-vacancies</guid>
  <pubDate>Sat, 20 Sep 2014 20:52:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[URDIP Bioinformatics RA/JRF Vacancies]]></title>
  <description><![CDATA[
<p>CSIR - UNIT FOR RESEARCH AND DEVELOPMENT OF INFORMATION PRODUCTS (CSIR- URDIP)</p>

<p>Adv. No. URDIP/ 6/2014</p>

<p>Opportunity for young Bioinformatics Professionals to make a career in the area of Intellectual Property CSIR has set up a Unit for Research and Development of Information Products (CSIR-URDIP) at Pune to work in the area of scientific informatics. One of the major focus areas of research work at CSIR-URDIP is PATENT INFORMATICS. With the increasing applications of Bioinformatics in the areas of life sciences industry such as Agriculture and Health Care (Diagnostics and Drugs), the output of research in these area is being protected by different forms of Intellectual Property rights. Realizing the importance of IP in the Bioinformatics field, Department of Biotechnology (DBT) has sanctioned a project on “Development, Facilitation and Harvesting of Bioinformatics related Intellectual Property” at CSIR-URDIP.</p>

<p>The project will involve application of Patent Informatics tools and techniques to Bioinformatics (including creation of patent landscapes, preparation of techno-legal reports of patentability, freedom to operate studies) to help protect IPRs and develop and conduct training programmes on IPRs related to Bioinformatics.</p>

<p>CSIR-URDIP invites applications from young Bioinformatics professionals to work on this emerging area which offers challenging opportunities and attractive career possibilities in future.</p>

<p>Position I: Research Associate</p>

<p>No of Positions: One</p>

<p>Consolidated amount Payable: Rs. 22,000/- per month + 20% HRA= Rs.26,400</p>

<p>Qualification:  PhD in Bioinformatics. In exceptional cases, candidature of M. Tech. candidates with First class in Bioinformatics with three years of relevant work experience will also be considered.</p>

<p>Age Limit: 35 years. The age should not exceed the limit indicated as on a closing date of receipt of completed application form.</p>

<p>Upper age limit is relaxable for 5 years for SC/ST, OBC, Physically handicapped and female candidates as per CSIR/Government of India rules.</p>

<p>Position II: Junior Research Fellow</p>

<p>No of Positions: one</p>

<p>Consolidated amount Payable: Rs. 16,000/- + 20% HRA = 19,200</p>

<p>Qualification: M.Sc / BE or equivalent in Bioinformatics with minimum of 55% marks in aggregate Job requirement: Scientific literature and patent search, analysis and Report Writing</p>

<p>Preference: Preference will be given to candidates with knowledge of patents and or 1-2 years of experience + Knowledge of Computers (MS Excel + Word Processing)</p>

<p>Age Limit: 28 years. The age should not exceed the limit indicated as on a closing date of receipt of completed application form.</p>

<p>For details please visit our website (www.urdip.res.in/careers) for further details and apply online by 30th September, 2014.</p>

<p>Advertisement: http://www.urdip.res.in/download/Advt6_2014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17176/arvados</guid>
	<pubDate>Sat, 20 Sep 2014 16:54:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17176/arvados</link>
	<title><![CDATA[Arvados]]></title>
	<description><![CDATA[<p>Arvados is a free and open&nbsp;source bioinformatics&nbsp;platform for genomic and&nbsp;biomedical data. User can&nbsp;Store | Organize | Compute | Share the data for free.&nbsp;</p>
<p><img src="https://arvados.org/images/dax.png" width="400" height="535" alt="image" style="border: 0px;"></p><p>Address of the bookmark: <a href="https://arvados.org/" rel="nofollow">https://arvados.org/</a></p>]]></description>
	<dc:creator>Martin Jones</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17504/postdoc-scientist-bioinformatics-at-ccmb</guid>
  <pubDate>Fri, 26 Sep 2014 19:58:41 -0500</pubDate>
  <link></link>
  <title><![CDATA[PostDoc Scientist Bioinformatics at CCMB]]></title>
  <description><![CDATA[
<p>1. Project Assistant/Junior Research Fellow/ Project Fellow [PA_JRF_PF]</p>

<p>a) M.Sc/or equivalent in biological sciences/related areas [Position Code: PA_JRF_PF_a]<br />b) B.E/B.Tech/ M.Sc in biotechnology/bioinformatics/computer science/Chemistry/Physics or MCA [Position Code: PA_JRF_PF_b]<br />c) M.Sc/or equivalent in wildlife sciences/ecology/environmental sciences or MBBS/BVSc/MVSc. [Position Code: PA_JRF_PF_c]</p>

<p>(Candidates with result awaited are NOT eligible to apply)</p>

<p>Upper Age limit 28years</p>

<p>Rs.12000 / Rs.16000 (as sanctioned by the funding agency)</p>

<p>2. Post Doctoral Fellow/Research Associate in multiple research areas [PDF_RA]</p>

<p>Ph.D. (submitted/awarded) in any branch of biological Sciences. Candidates with Ph.D. in other sciences are also encouraged to apply.</p>

<p>Experience in molecular biology, biochemistry, structural biology, cell biology, infectious disease, conservation genetics, veterinary science, reproductive biology, and molecular diagnostics is desired but not mandatory.</p>

<p>[Position Code: PDF_RA]</p>

<p>UpperAge limit 35years</p>

<p>Rs. 22000- 26000 (as sanctioned by the funding agency)</p>

<p>3. Post Doctoral Scientist Fellow [PDSF]</p>

<p>Ph.D in any of the following areas: bioinformatics, next generation sequencing, high throughput data analysis, proteomics, bio-statistics, computer science, information technology, computer hardware and networking/clustering, parallel processing.<br />[Position Code: PDSF]</p>

<p>Upper Age limit 40 years</p>

<p>Rs. 40000 consolidated (as sanctioned by the funding agency)</p>

<p>Download Application: Last date for apply online: 09th Oct 2014</p>

<p>Advertisement: www.ccmb.res.in//index.php?view=notifications&amp;mid=0&amp;id=71&amp;nid=38</p>

<p>Apply online http://www.ccmb.res.in/positions/temp_notif/online_form.html</p>

<p>More at http://www.ccmb.res.in//index.php?view=notifications&amp;mid=0&amp;id=71&amp;nid=38</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/17652/arraygen-bioinformatics-genomics-group</guid>
  <pubDate>Sun, 28 Sep 2014 14:09:55 -0500</pubDate>
  <link></link>
  <title><![CDATA[ArrayGen Bioinformatics Genomics Group]]></title>
  <description><![CDATA[
<p>ArrayGen is a global bioinformatics company which is a one stop solution for microarray designing and genomics data analysis. Our novel Array Design Approach Strategy (ADAS) aims to condense the time lag between demands of scientific community and manufacture industry, thereby expediting research processes.</p>

<p>ArrayGen specializes in Genomics data analysis and research, as we believe in the level of precision, predictability, benchmark-ability, and data analysis capability of genomics data over other forms of biological data. ArrayGen constantly strives to develop new solutions, and plug the existing gaps in the technological advancement of the field.</p>

<p>More http://www.arraygen.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/17873/postdoc-position-in-protein-annotation-and-machine-learning-paris-france</guid>
  <pubDate>Sat, 04 Oct 2014 08:10:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position in protein annotation and machine learning - Paris, France]]></title>
  <description><![CDATA[
<p>We are interested in finding an excellent postdoc with interests in protein functional annotation, machine learning and computer grids. The position is open for 3.5 years at the Université Pierre et Marie Curie, in the heart of Paris.</p>

<p>Research topic: Protein function annotation, multiple probabilistic models, domain architecture, machine learning, combinatorial optimization, computer grid.</p>

<p>This project is run on the Laboratoire de Biologie Computationnelle et Quantitative UMR7238 CNRS-UPMC – Analytical Genomics team, headed by A.Carbone. It is co-advised with Pierre-Henri Wuillemin, Laboratoire d’Informatique de Paris 6 – Equipe DECISION.</p>

<p>The postdoc will be payed under a contract of Ingénieur de Recherche lasting 3.5 years and it is available from September 1st, 2014.</p>

<p>Group Web Page: http://www.lcqb.upmc.fr/AnalGenom/home.html</p>

<p>Ref. E-Mail: Alessandra Carbone alessandra.carbone@lip6.fr</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/18819/jrfsrf-at-jawaharlal-nehru-institute-ofadvanced-studies-jnias-hyderabad</guid>
  <pubDate>Fri, 31 Oct 2014 08:48:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF/SRF at Jawaharlal Nehru Institute ofAdvanced Studies (JNIAS), Hyderabad]]></title>
  <description><![CDATA[
<p>Applications for Academic Projects in Biotechnology, Bioinformatics, Environmental Sciences and Computer Science &amp; Engineering</p>

<p>About JNIAS<br />Jawaharlal Nehru Institute of Advanced Studies (JNIAS), Hyderabad has been established by Dr. D. Swaminadhan Research Foundation (DSRF), Hyderabad as a Research and Educational Institution with a view to contribute in developing advanced technologies and build „core competence‟ in specific areas. The activities of JNIAS involves: Education, Research Training and Innovations in the fields of Sciences, Technologies, Humanities and Social Sciences. It aims to blossom into an Advanced Institute of education and research with a reservoir of expertise and experience in the relevant fields and the necessary capability to harness multi-disciplinary research and studies. JNIAS has been recognized as an Advanced Research Institute by Jawaharlal Nehru Technological University Hyderabad (JNTUH), Hyderabad and Jawaharlal Nehru Technological University Anantapur (JNTUA), for offering Ph.D., P.G M.Phil, P.G Diploma and Training Programmes in Sciences and Engineering &amp; Technology.</p>

<p>Jawaharlal Nehru Architecture and Fine Arts University (JNAFAU) Hyderabad also recognized JNIAS for offering UG, PG degree in Architecture.</p>

<p>Projects &amp; Facilities</p>

<p>JNIAS offers wide range of projects:</p>

<p>Biotechnology area:</p>

<p>Molecular Biology<br />Microbiology<br />Nanotechnology<br />Bioinformatics (Schrodinger Software)<br />In Silico studies &amp; Drug Designing<br />Sequence analysis<br />Protein structure function studies</p>

<p>Registration<br />Tuition Fees: Interested students need to pay the following tuition fees:<br />1. Six Month’s Project: Rs. 20,000/-<br />2. Four Month’s Project: Rs. 15,000/-<br />3. Three Month’s Project: Rs. 10,000/-<br />4. One Month - Hands on Training : Rs. 8,000/-</p>

<p>For enquires call:<br />91-7893203414 (Biotechnology), 91-9949582263 (Environmental Sciences) 91-8977369305 (Computer Science)</p>

<p>Interested student may download the application from the website (www.jnias.in) and send the hard copy of the completed application forms and Curriculum Vitae along with the Demand Draft drawn on any nationalized Banks in favor of “The Registrar, JNIAS, Secunderabad”. Application forms can be sent through email to academicprojects@jnias.in</p>

<p>Address<br />Jawaharlal Nehru Institute of Advanced Studies (JNIAS)<br />6th Floor, Buddha Bhavan, M.G Road,<br />Secunderabad - 500 003<br />Andhra Pradesh, India<br />Tele/Fax: 040- 27541551; 27541553<br />Mobile: 08885541554<br />Web site: www.jnias.in</p>

<p>Brochure : https://drive.google.com/file/d/0B3zPwhgA-u-nU0dyMFd2OWcxNUpSTWNYc0xDSGs5UDI4UDNB/view?usp=sharing</p>
]]></description>
</item>

</channel>
</rss>