Address of the bookmark: https://github.com/martinjvickers/KAST

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Address of the bookmark: https://github.com/sc932/ALE

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

To find repeats in a genome from 2 to 9 length using a Perl script, you can use the RepeatMasker tool with the "--length" option[0]. Here's a step-by-step guide:

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

• Using state of the art tools, easily extended for other viruses

• Tool and database updates for critical components via Conda

• Built using modern design patterns with Conda and Snakemake

• Extensible and easy to customize

• Submission Ready Genomes

• Customizable reporting with comprehensive visualization

https://ikim-essen.github.io/uncovar/

Github https://github.com/IKIM-Essen/uncovar

Address of the bookmark: https://ikim-essen.github.io/uncovar/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Key Findings:

1. Chromosomal Fusion and Its Molecular Signature:

   • The fusion site is located at 2q13–2q14.1 and is characterized by degenerate telomeric sequences appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.
   • Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.

2. Extensive Duplications in the Surrounding Genomic Region:

   • The study identifies large-scale segmental duplications flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.
   • These duplications are predominantly located in subtelomeric and pericentromeric regions, suggesting their role in genomic instability and chromosomal evolution.

3. Paralogous Regions and Their Evolutionary Relationships:

   • A 168-kilobase (kb) segment near the fusion site has 98%–99% sequence identity with three regions on chromosome 9 (9pter, 9p11.2, and 9q13).
   • Another 67-kb region distal to the fusion site shows a high degree of homology to sequences in chromosome 22qter.
   • Additionally, a 100-kb segment exhibits 96% sequence identity with a region in chromosome 2q11.2.

4. Comparative Genomics and Evolutionary Implications:

   • By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.
   • The presence of specific repetitive elements within these duplicated segments serves as evolutionary markers that help infer their historical rearrangements.
   • Some of these duplicated regions are associated with chromosomal inversion breakpoints, potentially contributing to evolutionary changes in primates.
   • Recurrent structural rearrangements in these regions have been linked to human chromosomal disorders.

Conclusions and Implications:

• The findings provide valuable insights into the structural evolution of human chromosome 2, which played a crucial role in human speciation.
• Understanding these segmental duplications and their evolutionary trajectories sheds light on genomic instability, which may contribute to human genetic diseases.
• The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the evolutionary divergence of humans from other primates.

This research advances our understanding of human genome evolution and offers a foundation for studying the effects of structural variants in genetic disorders.