<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14302?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/14302?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</guid>
	<pubDate>Wed, 21 Aug 2013 10:50:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2741/bioinformatician-dreams</link>
	<title><![CDATA[Bioinformatician Dreams]]></title>
	<description><![CDATA[<p>Bioinformatician life is interconnected, they always dream for a powerful server, little more space on server as they are generating lots of data per run, dream to publish results in good impact journals, meetings reminders :) and research analysis off course!!!&nbsp;</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2741" length="557537" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/6052/university-of-california-irvine-center-for-complex-biological-systems</guid>
	<pubDate>Mon, 04 Nov 2013 17:10:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/6052/university-of-california-irvine-center-for-complex-biological-systems</link>
	<title><![CDATA[University of California, Irvine - Center for Complex Biological Systems]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/chPJ6OdVl4o" frameborder="0" allowfullscreen></iframe>The University of California Irvine's Center for Complex Biological Systems got its start just as there was a revolution in biology. Systems Biology requires that scientists work across many disciplines including engineering, physics and mathematics. The Center specializes in helping form the kinds of teams that will propel biological research into the future. It is also proud to be able to train students in the new interdisciplinary approach.

http://ccbs.uci.edu]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23119/senior-statistician-manchester-or-belfast-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:06:04 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Statistician - Manchester or Belfast UK]]></title>
  <description><![CDATA[
<p>The Role</p>

<p>My client provide innovative biomarker discovery and development services to the pharmaceutical industry.  They partner with the pharmaceutical industry to develop and implement biomarker strategies, providing a full range of biomarker services from pre-clinical biomarker discovery, assay development, right through to the delivery of clinical tests in their CLIA lab.</p>

<p>As a Senior Statistician you would support this effort and be responsible for the management of technical experimental study design and data handling processes required for the discovery, development and commercial delivery of multiplex clinical diagnostic assays; You will:</p>

<p>Develop analytical experimental designs for multiplex clinical diagnostic assays in accordance with regulatory requirements (e.g. CLIA, FDA)<br />Lead and coordinate the evaluation of analytical studies including characterization, verification, and validation studies<br />Lead specification setting and specification alterations<br />Ensure DOE methodology is routinely used in analytical studies.<br />Work with the Operations Department to ensure robust, reproducible and precise assay development<br />Provide expertise of general aspects for Statistical Process Control<br />Provide statistical expertise for R&amp;D, Quality, and Manufacturing<br />You will work in a fast-paced, project orientated environment and the ability to plan and execute objectives under tight timelines is a must. This is a unique opportunity suited for a qualified statistician with an interest in working to deliver first class data analysis support and solutions in a clinical setting.</p>

<p>Requirements</p>

<p>MSc or PhD in statistics or a related discipline<br />In depth knowledge of DOE methods to analytically validate, monitor and trouble shoot multiplex clinical diagnostic assays, ideally in a commercial/industrial setting<br />Experienced in the analysis of statistical technology evaluation, independent data and dependent data analysis, medical diagnostic accuracy, statistical graphics and reproducible reporting.<br />Excellent interpersonal, communication (including written and spoken English)<br />Ability to independently manage multiple projects and to deliver results on time per project deadlines<br />Proficient programming and analysis skills in one or more statistical package (e.g. R, Stata, SAS)<br />The following skills, while not mandatory, are highly desirable:</p>

<p>Development and validation of predictive models<br />Experience of clinical epidemiology, survival analysis, biomarker research, Bayesian methods, quantifying predictive accuracy.<br />Knowledge of regulatory standards for CLIA and/or FDA IVD tests<br />Reward</p>

<p>An attractive remuneration package will reflect the importance of this role and will include 6.8 weeks annual leave (pro rata, including fixed closure days), company pension scheme, enhanced sick pay and maternity entitlements, healthcare plan and opportunities for learning and development, as well as access to a company restaurant and parking facilities</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</guid>
	<pubDate>Sun, 16 Mar 2014 06:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/9207/biogeek-fun</link>
	<title><![CDATA[BioGeek Fun]]></title>
	<description><![CDATA[<p>1. A futuristic computational biology student was told to write "It is in my gene!!!" on the board 100 times as a punishment. here's his response -<br /><br />use warnings;<br />for ($count=1; $count &lt;=100; $count++) { print "It is in my gene!!!";}<br /><br />I guess, he is gonna to be a real biogeek. Nice try though. Smart kid.</p><p>&nbsp;</p><p>2. In some perl script I found this <br />&nbsp;. . . . . .<br />&nbsp;. . . . . .<br /># It works for me, only God understood how it is working<br />while (/(&lt;\/[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)|(&lt;[^&gt;]+&gt;)$|([^&gt;&lt;]+)/go) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $startGene=$1;<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; $beginChromosome=$2;<br />&nbsp;&nbsp; &nbsp;<br />. . . . . .<br />&nbsp;.. . . . . .<br />}</p><p>&nbsp;</p><p>3. One more interesting message in Perl found &hellip;. It will must tickle you bone :) <br />open(my $fh, "&lt;", "gene.txt")&nbsp;&nbsp; &nbsp;or kill " Me if you think this is a mistake :$!";<br /><br /></p><p>&nbsp;</p><p>4. From the Perl <br /><br />&nbsp; while () {&nbsp; # "The Mothership Connection is here!"<br />&nbsp;&nbsp; &nbsp;print &ldquo;$_\n&rdquo;; # Printing the offspring :)</p><p>&nbsp;</p><p>5. Perl message<br />if ($1) { print &ldquo;Just found a the error in chromosome !!!, yahoo&hellip;&rdquo;; else { &ldquo;That is not error, but mutation you moron!&rdquo;;</p><p>&nbsp;</p><p>6. One genome database curator walk in wine bar asked the bartender:<br />CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/44845/a-bioinformatician%E2%80%99s-lament</guid>
	<pubDate>Thu, 29 May 2025 01:33:31 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/44845/a-bioinformatician%E2%80%99s-lament</link>
	<title><![CDATA[A Bioinformatician’s Lament]]></title>
	<description><![CDATA[<div><div dir="auto"><p><em>"I have a presentation tomorrow,"</em>&nbsp;they say,</p><p>With hopeful eyes, like it&rsquo;s all child's play.<br />As if results bloom overnight, full-grown&mdash;<br />Not wrangled from chaos, and error-prone.</p><p><strong>Oh brave soul, sit, let&rsquo;s walk through the tale,</strong><br />Of pipelines broken and servers that fail.<br />The journey starts: &ldquo;The data? It&rsquo;s there&mdash;<br />Just fetch it from S3, easy, I swear.&rdquo;</p><p>Now I summon&nbsp;<code>awscli</code>&nbsp;with dread,<br />Reset my keys, credentials fed.<br />Configure regions, IAM roles too&mdash;<br />All this, and still no peek at the view.</p><p>Next up, the tool: &ldquo;It&rsquo;s open source!&rdquo;<br />On GitHub, rotting, no sign of remorse.<br />Python 2.7, some GCC trick&mdash;<br />The install alone might make you sick.</p><p>Finally, progress! The pipeline runs&hellip;<br />Till RAM collapses and error stuns.<br />Oh, and the metadata? A crime,<br />Merged cells, font soup, out of time.</p><p>Sample IDs&mdash;what a cryptic game:<br /><code>Sample_1</code>,&nbsp;<code>S1</code>,&nbsp;<code>sample-1</code>... the same?<br />Controls mislabeled, cases flipped,<br />No wonder my sanity's starting to slip.</p><p>Then QC plots, PCA joy&mdash;<br />Wait, that&rsquo;s a tumor labeled as a boy?<br />Clusters cross, and axes lie,<br />And I still don&rsquo;t know&nbsp;<em>which</em>&nbsp;sample&rsquo;s "guy."</p><p>But the clock ticks on, and it&rsquo;s half-past doom,<br />They want the final UMAP soon.<br />With pastel colors, labeled clear&mdash;<br />"Can we move that legend to&nbsp;<em>right here</em>?"</p><p>Tweak by tweak, I adjust each frame,<br />Resize Panel B, annotate a name.<br />Export the plot&mdash;it starts to gleam&hellip;<br />Then my laptop crashes. I scream.</p><p>This is the grind, the long-haul game,<br />Where science hides behind code and flame.<br />No &ldquo;Export to Nature&rdquo; button to press,<br />Just toil and logic and hope for success.</p><p>So next time you whisper that fated line&mdash;<br />&ldquo;I have a talk, can you make it shine?&rdquo;<br />Know: bioinformatics is craft, not a click,<br />It&rsquo;s science with scars, not just a quick fix.</p><p><strong>To all who debug at 3AM light,</strong><br />Who ghostwrite figures through sleepless night&mdash;<br />You are the backbone, silent and true,<br />First-author-worthy, if only they knew.<br /><br /></p><hr><p><em><br />"कल मेरी प्रेज़ेंटेशन है,"</em>&nbsp;वो कहते हैं,</p></div></div><div><div dir="auto"><p>आशा भरी आँखों से, जैसे सब सहज है।<br />जैसे परिणाम रातोंरात प्रकट हो जाएं&mdash;<br />ना कि डेटा की भूलभुलैया से उखाड़े जाएं।</p><p><strong>आओ बैठो, एक किस्सा सुनाता हूँ,</strong><br />जहाँ पाइपलाइन टूटती है, और सर्वर भी थक जाते हैं।<br />कहानी शुरू होती है: &ldquo;डेटा तो है&mdash;<br />बस S3 बकेट में, एकदम पास में कहीं।&rdquo;</p><p>अब&nbsp;<code>awscli</code>&nbsp;बुलाता हूँ डरते हुए,<br />कुंजी सेट करूँ, क्रेडेंशियल जोड़ूं, रीजन भरूँ।<br />इतनी मशक्कत, फिर भी डेटा नहीं मिला,<br />बस सेटअप में ही पूरा दिन चला।</p><p>फिर आता है टूल: &ldquo;ओपन-सोर्स है!&rdquo;<br />GitHub पर है, 2019 से सूखा पड़ा है।<br />Python 2.7 चाहिए, एक पुराना कम्पाइलर,<br />और साथ में थोड़ी सी दुआ की ताकत।</p><p>आख़िरकार टूल चला, खुशी सी हुई,<br />लेकिन रन करते ही, मेमोरी ने हार मानी।<br />और मेटाडेटा? एक एक्सेल की आफ़त,<br />मर्ज़ किए हुए सेल, बस और क्या चाहिए काफ़ियत?</p><p>सैंपल आईडी? बस भगवान ही जाने&mdash;<br /><code>Sample_1</code>,&nbsp;<code>sample-1</code>,&nbsp;<code>S1</code>, और&nbsp;<code>control1</code>&mdash;<br />ये सब एक ही सैंपल हैं क्या?<br />पता तब चलता है जब पूछो दो-तीन बार।</p><p>काउंट मैट्रिक्स तैयार, अब R या Python की बारी,<br />QC करो, PCA प्लॉट&mdash;पर कुछ गड़बड़ भारी।<br />ट्यूमर और नॉर्मल का अदला-बदली खेल,<br />बार-बार, वही पुरानी झमेल।</p><p>आख़िर में आया मॉडलिंग का समय,<br />स्टैट्स, प्लॉट्स, डिफरेंशियल एक्सप्रेशन का श्रम।<br />लेकिन घड़ी में 5 बज चुके हैं जनाब,<br />और 8 बजे तक UMAP चाहिए, साफ़-सुथरा जबाब।</p><p>तो मैं कोड लिखता हूँ रात भर बैठ कर,<br />कलर पैलेट, जीन लेबल, लीजेंड बाहर रख कर।<br />फ़ॉन्ट, पैनल, एक्सिस सब सुधार,<br />एक्सपोर्ट करता हूँ... और लैपटॉप कहता है&mdash;"अब नहीं यार!"</p><p>इसीलिए बायोइन्फॉर्मेटिक्स में लगता है समय,<br />ये &ldquo;बस सीरत चलाओ&rdquo; या &ldquo;वोल्कैनो प्लॉट बनाओ&rdquo; नहीं है।<br />ये है सिस्टम एडमिन का काम, डेटा की सफ़ाई,<br />QC, डिबगिंग, और सांइस की सच्ची लड़ाई।</p><p><strong>तो कुछ सीखें इस व्यथा से आप भी आज:</strong><br />24 घंटे पहले चमत्कार मत माँगिए।<br />अच्छे फ़िगर साफ़ डेटा से बनते हैं।<br />बायोइन्फॉर्मेटिक्स जादू नहीं, विज्ञान है।<br />समय से बात कीजिए, प्रक्रिया का सम्मान कीजिए।</p><p><strong>और उन सभी बायोइन्फॉर्मेटिशियनों को सलाम,</strong><br />जो दूसरों की प्रेज़ेंटेशन के लिए रातों में जागते हैं&mdash;<br />तुम हो फ़िगर्स के भूत लेखक,<br />तुम हो बिना नाम के सह-लेखक।<br />तुम पहले लेखक बनने के हक़दार हो&mdash;<br />और एक लंबी नींद के भी।</p><p>Note: Written with the help of AI/LLM Tools !</p></div></div>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/34611/talkowski-laboratory</guid>
  <pubDate>Mon, 11 Dec 2017 12:17:42 -0600</pubDate>
  <link></link>
  <title><![CDATA[Talkowski Laboratory]]></title>
  <description><![CDATA[
<p>The Talkowski laboratory explores the impact of genomic alterations on human neurodevelopment and neuropsychiatric disorders, and the application of innovations in sequencing technology to genetic diagnostics. Mike received undergraduate degrees in Biology and Psychology and a Ph.D. in Human Genetics with a focus in genetic epidemiology and psychiatric genetics. He joined the Center for Human Genetic Research (CHGR) of Massachusetts General Hospital, the Department of Neurology in Harvard Medical School, and the Program in Medical and Population Genetics at the Broad Institute as a Postdoctoral Fellow with Dr. James Gusella, Director of the CHGR, in 2008 to study the genetic etiology of neurodevelopmental disorders, particularly autism spectrum disorders. He was appointed to the faculty of the CHGR and Harvard Medical School in 2011. </p>

<p>http://talkowski.mgh.harvard.edu</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/2645/dna-bending-propensity-in-the-presence-of-base-mismatches-implications-for-dna-repair</guid>
	<pubDate>Mon, 19 Aug 2013 16:01:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/2645/dna-bending-propensity-in-the-presence-of-base-mismatches-implications-for-dna-repair</link>
	<title><![CDATA[DNA Bending Propensity in the Presence of Base Mismatches: Implications for DNA Repair]]></title>
	<description><![CDATA[<p>Understanding how the human body recognizes damaged DNA and initiates repair fascinates Michael Feig, professor of biochemistry and molecular biology at Michigan State University. Feig studies the proteins MutS and MSH2-MSH6, which recognize defective DNA and initiate DNA repair. Natural DNA repair occurs when proteins like MutS (the primary protein responsible for recognizing a variety of DNA mismatches) scan the DNA, identify a defect, and recruit other enzymes to carry out the actual repair.</p><p><em>Results from computer simulations show that it is energetically less expensive to bend mismatch-containing, defective DNA (G:T, C:C, C:T, G:A, G:G, T:T, A:A, A+:C) vs. non-defective DNA (containing A:T or G:C base pairs). DNA repair mechanisms likely take advantage of this feature to detect defective DNA based on an increased bending propensity.</em></p><p>http://www.tacc.utexas.edu/news/feature-stories/2013/how-dna-repair-helps-prevent-cancer</p><p>http://pubs.acs.org/doi/abs/10.1021/jp403127a</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4656/pandey-lab</guid>
  <pubDate>Fri, 20 Sep 2013 13:19:18 -0500</pubDate>
  <link></link>
  <title><![CDATA[Pandey Lab]]></title>
  <description><![CDATA[
<p>The Pandey Lab at Johns Hopkins University is a Systems Biology lab that combines molecular biology, analytical chemistry and computational biology with various "Omics" technologies including genomics and proteomics to understand signaling pathways and to identify therapeutic targets and biomarkers in a number of cancers.</p>

<p>More at http://pandeylab.igm.jhmi.edu/</p>

<p>http://scholar.google.com/citations?user=OhuG0FcAAAAJ&amp;hl=en</p>
]]></description>
</item>

</channel>
</rss>