<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14302?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/14302?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</guid>
	<pubDate>Sat, 17 Aug 2013 10:30:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</link>
	<title><![CDATA[Bioinformatician needs ten heads !!!]]></title>
	<description><![CDATA[<p>Bioinformatics demands more and ... lots more knowledge. In this case Ravan, a mythological character from the Ramayan, can only be a real bioinformatician. :) :P</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2534" length="90547" type="image/jpeg" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/35257/india-and-germany-to-begin-joint-research-in-the-area-of-bioinformatics-in-health-research</guid>
	<pubDate>Wed, 17 Jan 2018 14:10:36 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/35257/india-and-germany-to-begin-joint-research-in-the-area-of-bioinformatics-in-health-research</link>
	<title><![CDATA[India and Germany to begin joint research in the area of 'Bioinformatics in Health Research']]></title>
	<description><![CDATA[<p><span>To facilitate bilateral cooperation in biotechnology between the scientific communities of India and Germany, the Department of Biotechnology (DBT) will soon begin collaborative research in the identified priority area of 'Bioinformatics in Health Research' under the programme of Indo-German Cooperation in Health Research.&nbsp;</span><br /><br /><span>The purpose of the programme is to stimulate new collaborations, e.g. the preparation of joint projects under national funding programmes. The programme facilitates bilateral cooperation in biotechnology between the scientific communities of India and Germany by way of joint research projects which will encompass bilateral workshops/seminar and exchange visits of scientists.&nbsp;</span><br /><br /><span>The programme is being implemented within the agreement of Indo-German cooperation in S&amp;T of 1974, under which the Department of Biotechnology, Government of India and Forschungszentrum Julich BMBH (FZJ), Federal Republic of Germany, have agreed for cooperative programme in biotechnology.</span><br /><br /><span>DBT of the Ministry of Science &amp; Technology, Government of India and the Project Management Agency at the German Aerospace Center (DLR-PT, European and International Cooperation), Bonn are the nodal implementing agencies from the Indian and German side respectively.</span><br /><br /><span>Through this programme, it is expected that the funded cooperation enables the partners to develop applicable scientific results which can be published and/ or could be commercialised and may lead to formation of joint ventures. All publications, patents coming out of these projects, need to be jointly authored by both Indian and German scientists. All necessary approvals like ethical clearance, HMSC approval from Indian point of view as well as EU, if applicable, from German point of view, e.g. before conducting animal experimentation if any needs to be obtained by PIs before undertaking the project.&nbsp;</span><br /><br /><span>Now, both the nodal agencies have invited research proposals in identified priority area of 'Bioinformatics in Health Research' from eligible scientists.&nbsp; Joint research projects are required to be submitted to both the nodal agencies by 15 January 2018. Scientists/faculty members working in regular capacity in universities, national R&amp;D laboratories/institutes and private R&amp;D institutes can be part of this joint research programme.&nbsp;&nbsp; For the private sector, partners from all kind of private sectors are eligible, but financing is limited. For Indian scientists from the private sector, only local hospitality in Germany as part of the exchange visit is available from the German side.&nbsp; For German scientists from the private sector, only travel costs are available for small and medium size enterprises (for definition of SME ref. to 2003/361/EC) as well as local hospitality in India will be borne by themselves.</span></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/6052/university-of-california-irvine-center-for-complex-biological-systems</guid>
	<pubDate>Mon, 04 Nov 2013 17:10:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/6052/university-of-california-irvine-center-for-complex-biological-systems</link>
	<title><![CDATA[University of California, Irvine - Center for Complex Biological Systems]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/chPJ6OdVl4o" frameborder="0" allowfullscreen></iframe>The University of California Irvine's Center for Complex Biological Systems got its start just as there was a revolution in biology. Systems Biology requires that scientists work across many disciplines including engineering, physics and mathematics. The Center specializes in helping form the kinds of teams that will propel biological research into the future. It is also proud to be able to train students in the new interdisciplinary approach.

http://ccbs.uci.edu]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</guid>
	<pubDate>Mon, 14 May 2018 16:33:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36603/learning-python-programming-a-bioinformatician-perspective</link>
	<title><![CDATA[Learning Python Programming - a bioinformatician perspective !]]></title>
	<description><![CDATA[<p>Python Programming&nbsp;is a general purpose programming language that is open source, flexible, powerful and easy to use. One of the most important features of python is its rich set of utilities and libraries for data processing and analytics tasks. In the current era of big biological data, python and biopython is getting more popularity due to its easy-to-use features which supports big data processing.</p><p>In this tutorial series article, I will explore features and packages of python which are widely used in the big data, NGS, and bioinformatics. I will also walk through a real biological example which shows NGS data processing with the help of python packages and programming.</p><p>Python has a couple of points to recommend it to biologists and scientists specifically:</p><ul>
<li>It's widely used in the scientific community</li>
<li>It has a couple of very well designed libraries for doing complex scientific computing (although we won't encounter them in this book)</li>
<li>It lend itself well to being integrated with other, existing tools</li>
<li>It has features which make it easy to manipulate strings of characters (for example, strings of DNA bases and protein amino acid residues, which we as biologists are particularly fond of)</li>
</ul><p>In general, following are some of the important features of python which makes it a perfect fit for rapid application development.</p><ul>
<li>Python is interpreted language so the program does not need to be compiled. Interpreter parses the program code and generates the output.</li>
<li>Python is dynamically typed, so the variables types are defined automatically.</li>
<li>Python is strongly typed. So the developers need to cast the type manually.</li>
<li>Less code and more use makes it more acceptable.</li>
<li>Python is portable, extendable and scalable.</li>
</ul><p>There are two major Python versions, Python 2 and Python 3. Python 2 and 3 are quite different. This tutorial uses Python 3, because it more semantically correct and supports newer features.</p><p>I will post tutorial on daily basis on this page. Check the sub-pages on right side.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/2383/golden-rules-of-bioinformatics</guid>
	<pubDate>Wed, 14 Aug 2013 21:11:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/2383/golden-rules-of-bioinformatics</link>
	<title><![CDATA[Golden Rules of Bioinformatics]]></title>
	<description><![CDATA[<ol>
<li>All constant are variable.</li>
<li>Copy and paste is a genetic error.</li>
<li>First solve the problem, then write the code.</li>
<li>No matter what goes wrong, it will probably look right.</li>
<li>Any simple problem can be insoluble if enough metting are held to discuss it. :P</li>
<li>Stastics is a systematic method of comming to the wrong conclusion with confidence.</li>
<li>Bug is a undocumented feature in programming languages.</li>
<li>Good biological programmer goes on summer holiday with raincoat. [because see 1]</li>
<li>Thanks god Google know python is not a python and multiplication and division are the same thing.</li>
<li>Don' be clever, complex biology will trick you.</li>
</ol>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</guid>
	<pubDate>Wed, 26 Feb 2014 17:50:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/8509/the-best-bioinformatics-computational-biology-quotes</link>
	<title><![CDATA[The Best Bioinformatics / Computational Biology Quotes]]></title>
	<description><![CDATA[<p><img src="http://bioinformaticsonline.com/mod//photo/hahaha.png" style="border: 0; border: 0px;" alt="image"></p><p>Bioinformatician are not anti-social; We are just genome friendly.</p><p>Bioinformatician would love to change the biological world, but they won't give us the genetic code :P</p><p>If at first you don't succeed; call it version 1.0</p><p>The glass is neither half-full nor half-empty: it's actually have several genomes.</p><p>I'm BioGeek.</p><p>Fedup with LIPS, try God script.</p><p>Idiot, Go ahead, make my data!</p><p>Thank god, my genome just compiled.</p><p>Error message: "Out of space on genome drive:"</p><p>Shut up mobile elements, or i'll flush you out.</p><p>Never underestimate the internet bandwidth, u gotta incomplete.</p><p>Applied fuzzy logic to understand God's logic?</p><p>Warning! Overflow, delete chromosome !</p><p>Be nice to the BioGeek, for all you know they might be the next curator!</p><p>Beware of computational biologist they screw genes and protein.</p><p>Warning! Your genome is full of garbage, delete it !</p><p>Bad or missing mouse genome. Spank the cat? (Y/N)</p><p>Genome make very fast, very accurate mistakes.</p><p>Let's BLAST it.</p><p>Some genome never has transposons. It just develops random features.</p><p>Go watch CINEMA and have BLAST.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/23959/bioinformatics-jokes</guid>
	<pubDate>Fri, 21 Aug 2015 01:26:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/23959/bioinformatics-jokes</link>
	<title><![CDATA[Bioinformatics Jokes !!]]></title>
	<description><![CDATA[<p>Why was the Bioinformatics fired from his job?</p><p>A: He was getting too Sassy.</p><p>&nbsp;</p><p>What did the bioinformatician say when he found out his team stopped using version control?</p><p>A: Y&rsquo;all better Git!</p><p>&nbsp;</p><p>Why did the computational biologist stay home from work?</p><p>A: He had a code!</p><p>&nbsp;</p><p>Why was the bioinformatician's paper was rejected?</p><p>A: Journal thought it seemed scripted.</p><p>&nbsp;</p><p>How can you tell that a Bioinformatics is working?</p><p>A: You can hear him Grunting!</p><p>&nbsp;</p><p>Why bioinformatician always silence?</p><p>A: Because bioinformatician calmly whisper, &ldquo;SSH&rdquo;</p><p>&nbsp;</p><p>Why was the bioinformatician always so sleepy?</p><p>A: He/She wasn&rsquo;t given any Java.</p><p>&nbsp;</p><p>Why did the program/software hanged?</p><p>A: Because genome float.</p><p>&nbsp;</p><p>Why was the class upset that its parent died?</p><p>A: Because it wouldn&rsquo;t be getting the inheritance!</p><p>&nbsp;</p><p>Why did bioinformatician always works on the command line?</p><p>A: Because they don't want to scare you with huge amount of data!</p><p>&nbsp;</p><p>Why did the bioinformatician attend the gay pride parade?</p><p>A: They supported polymorphism.</p><p>&nbsp;</p><p>Why did bioinformatician prefer awk, PerlOneliner?</p><p>A: Because even computer can't handle to load the data.</p><p>&nbsp;</p><p>Why don&rsquo;t bioinformatician get along with others?</p><p>A: They&rsquo;re too MEAN.</p><p>&nbsp;</p><p>Why computational biologist are cool?</p><p>A: Because they are scripted!!</p><p>&nbsp;</p><p>Why they talk $ unzip; strip; touch; finger; grep; mount; fsck; more; yes; fsck; fsck; umount; clean; sleep;</p><p>A: Ah, Ohhh, dude, these are *NIX commands</p><p>&nbsp;</p><p>Did they really hack genome?</p><p>A: Yes, I guess so.</p>]]></description>
	<dc:creator>Jitendra Prajapati</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/27250/lawley-lab</guid>
  <pubDate>Mon, 09 May 2016 03:29:51 -0500</pubDate>
  <link></link>
  <title><![CDATA[Lawley Lab]]></title>
  <description><![CDATA[
<p>Lawley Lab are covered with a complex microbial community, known as our microbiota, which plays important roles in our physiology, immunity, metabolism and sustenance. Within the human gastrointestinal tract alone there are over 1,000 bacterial species, which amounts to approximately 10 times more cells than we harbor in our entire body and 200 times more genes than are found within our genome. Lawley Lab are really a 'supraorganism' consisting of our 'human' and 'microbial' selves.</p>

<p>More at http://www.sanger.ac.uk/science/groups/lawley-lab</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/38422/simon-boulton-lab</guid>
  <pubDate>Tue, 11 Dec 2018 09:01:46 -0600</pubDate>
  <link></link>
  <title><![CDATA[SIMON BOULTON LAB]]></title>
  <description><![CDATA[
<p>DNA is quite fragile and easily damaged, both by the normal processes of life at work within our cells and by external agents such as the chemicals in tobacco smoke or ultraviolet (UV) rays from the sun. However, our cells have evolved clever ‘repair kits’ that spot DNA damage and patch it up, helping to protect us against tumours. If these repair kits are faulty or inefficient then mistakes can quickly build up and cause cells to become cancerous.</p>

<p>They are particularly interested in a type of DNA repair known as double-strand break repair, which happens when the DNA molecule has been completely snapped in two. Not only does this happen in normal cells in the body to repair DNA damage, but it also occurs when eggs and sperm are made (known as meiosis) and during the generation of cells in the immune system.</p>

<p>https://www.crick.ac.uk/research/labs/simon-boulton</p>
]]></description>
</item>

</channel>
</rss>