<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/14338?offset=1150</link>
	<atom:link href="https://bioinformaticsonline.com/related/14338?offset=1150" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/40882/troyanskaya-lab</guid>
  <pubDate>Tue, 04 Feb 2020 06:40:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[Troyanskaya Lab]]></title>
  <description><![CDATA[
<p>The goal of our research is to interpret and distill this complexity through accurate analysis and modeling of molecular pathways, particularly those in which malfunctions lead to the manifestation of disease. We are inventing integrative methods for systems-level pathway modeling through integrative analysis of genome-scale datasets. We apply these approaches in studying challenging biological problems, such as how pathways function in diverse cell types and how they change dynamically.</p>

<p>https://function.princeton.edu/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/42275/frequent-parameters-for-bioinformatics-tools</guid>
	<pubDate>Tue, 27 Oct 2020 19:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/42275/frequent-parameters-for-bioinformatics-tools</link>
	<title><![CDATA[Frequent parameters for bioinformatics tools !]]></title>
	<description><![CDATA[<div><div>Third party executable parameters and options.</div><div>&nbsp;</div><div>Trimmomatic</div><div>&nbsp;</div><div>&ldquo;ILLUMINACLIP:...:2:30:10&rdquo;</div><div>&ldquo;LEADING:15&rdquo;</div><div>&ldquo;TRAILING:15&rdquo;</div><div>&ldquo;SLIDINGWINDOW:4:20&rdquo;</div><div>&ldquo;MINLEN:20&rdquo;</div><div>&ldquo;TOPHRED33&rdquo;</div><div>&nbsp;</div><div>Filtlong</div><div>--min_length 500</div><div>--min_mean_q 85</div><div>--min_window_q 65</div><div>&nbsp;</div><div>FastQ Screen</div><div>--aligner bowtie2' (bwa for PacBio)</div><div>--subset 1000 (for PacBio)</div><div>&nbsp;</div><div>SPAdes</div><div>--careful</div><div>--disable-gzip-output</div><div>--cov-cutoff auto</div><div>--phred-offset 33</div><div>&nbsp;</div><div>HGAP</div><div>Pbalign.task_options.min_accuracy: 70</div><div>Pbalign.task_options.no_split_subreads: false</div><div>Genomic_consensus.task_options.min_confidence: 40</div><div>falcon_ns.task_options.HGAP_GenomeLength_str:</div><div>6000000</div><div>Pbcoretools.task_options.read_length: 0</div><div>Genomic_consensus.task_options.use_score: 0</div><div>Pbalign.task_options.min_length: 50</div><div>Pbalign.task_options.algorithm_options: --minMatch 12</div><div>--bestn 10 --minPctSimilarity 70.0</div><div>Pbalign.task_options.hit_policy: randombest</div><div>Pbcoretools.task_options.other_filters: rq &gt;= 0.7</div><div>Pbalign.task_options.concordant: false</div><div>Genomic_consensus.task_options.min_coverage: 5</div><div>falcon_ns.task_options.HGAP_SeedCoverage_str: 30</div><div>falcon_ns.task_options.HGAP_AggressiveAsm_bool: false</div><div>Genomic_consensus.task_options.algorithm: best</div><div>falcon_ns.task_options.HGAP_SeedLengthCutoff_str: -1</div><div>Genomic_consensus.task_options.diploid: false</div><div>&nbsp;</div><div>MeDuSa</div><div>-random 100</div><div>&nbsp;</div><div>Prokka</div><div>--usegenus</div><div>--force</div><div>--addgenes</div><div>--rfam</div><div>--rawproduct</div><div>&nbsp;</div><div>cmsearch (taxonomy, 16S)</div><div>--rfam</div><div>--noali</div><div>&nbsp;</div><div>blastn (taxonomy, 16S)</div><div>-evalue 1E-10</div><div>&nbsp;</div><div>blastn (MLST)</div><div>-ungapped</div></div><div><div>-dust no</div><div>-evalue 1E-20</div><div>-word_size 32</div><div>-culling_limit 2</div><div>-perc_identity 95</div><div>&nbsp;</div><div>blastp (VF)</div><div>-culling_limit 2</div><div>&nbsp;</div><div>RGI (ABR)</div><div>--input_type contig</div><div>&nbsp;</div><div>bowtie2 (mapping)</div><div>--sensitive</div><div>&nbsp;</div><div>minimap2 (mapping)</div><div>-a</div><div>-x map-ont</div><div>&nbsp;</div><div>samtools mpileup (SNP&nbsp;detection)</div><div>-uRI</div><div>&nbsp;</div><div>bcftools call (SNP detection)</div><div>--variants-only</div><div>--skip-variants indels</div><div>--output-type v</div><div>--ploidy 1</div><div>-c</div><div>&nbsp;</div><div>SNPsift filter (SNP detection)</div><div>"( QUAL &gt;= 30 ) &amp; (( na FILTER ) | (FILTER = 'PASS')) &amp;</div><div>( DP &gt;= 20 ) &amp; ( MQ &gt;= 20 )"</div><div>&nbsp;</div><div>SNPeff ann (SNP detection)</div><div>-nodownload</div><div>-no-intron</div><div>-no-downstream</div><div>-no SPLICE_SITE_REGION</div><div>-upDownStreamLen 250</div><div>&nbsp;</div><div>bcftools consensus</div><div>(phylogenetic tree)</div><div>--haplotype 1</div><div>&nbsp;</div><div>fasttreemp</div><div>-nt</div><div>-boot 100</div><div>&nbsp;</div><div>roary</div><div>-e</div><div>-n</div><div>-cd 100</div><div>-g 100000</div></div>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42664/common-bioinformatics-interview-questions</guid>
	<pubDate>Sat, 23 Jan 2021 06:07:50 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42664/common-bioinformatics-interview-questions</link>
	<title><![CDATA[Common Bioinformatics Interview Questions !]]></title>
	<description><![CDATA[<p>The possibility of an interview for a bioinformatics position in the life sciences may be very disquieting, but the same concerns emerge time and again in my experience. So, it is exceedingly worthwhile to plan for future bioinformatics interview questions. Doing this will really give you the advantage in obtaining the position.</p><p>The following 5 questions are those that I have heard many times during the job-search process. There is no reason for not planning responses in such situations.</p><p><strong>1. Tell Us About Yourself</strong><br />This is a very typical opener in interviews. It's a perfect question to ask, and getting something planned will really help you concentrate and ease in the conversation. However, you need to make sure that your response is applicable to the job you're interviewing.<br />It's probably better to keep your answer professional. Try to include these in the answer as well: where did your love of science and bioinformatics come from? How the heck did you end up in this field? Why programming and scripting ?</p><p><strong>2. What is your plan for your bioinformatics career? / How do you look at yourself in five years? / How are your personal objectives to accomplish these goals / What are the plan for your research fundings ?</strong></p><p>Your CV/resume has already impressed the selection panel if you have been invited for an interview. The questions from the bioinformatics interview team provide an incentive for you to market yourself and illustrate the work in question with the most appropriate knowledge.</p><p><strong>3. What do you understand about the job description/What would your suggested research path be if you were a successful candidate?</strong><br />Summarize the specifics of the advertised bioinformatics position in your own words. Follow on with some suggestions of how you want to extend your research and create your own projects within the community.</p><p><strong>4. Will you work as a group or do you want to work on your own?</strong><br />This requirement can vary from jobs to job, so when addressing, be alert. A company/research PI may need a bioinformatician that is able to work on a single project autonomously, or they may need a person who can help direct and organize a team. In your response, refer to the job description.</p><p><strong>5. What particular methods have you used to date with your experiments?</strong><br />You might have experience with all the laboratory techniques described in the job description, but stress the ones you highly experienced with. Highlight your professional abilities and stress that you are extremely capable of mastering new techniques with others ...</p><p>At the end of the day, remember that you're questioning the jury as well as they're interviewing you. You will ought to think of any questions you would like the interview panel to pose. This indicates that you have done your homework and serious about the position.</p><p>All the best for your future job interview.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/43044/kanthida-lab</guid>
  <pubDate>Wed, 28 Apr 2021 02:27:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[Kanthida Lab !]]></title>
  <description><![CDATA[
<p>Research Interest: </p>

<p>Bioinformatics </p>

<p>High-throughput and high-dimensional data analysis</p>

<p>Microbiome data analysis (Main focus)</p>

<p>Next-generation and third-generation sequencing data analysis for genomics</p>

<p>Gene expression data analysis</p>

<p>Machine learning for biological data</p>

<p>Biomarkers identification </p>

<p>Database and web-application for biological data</p>

<p>More at <br />https://sites.google.com/mail.kmutt.ac.th/kanthida-k/home?authuser=0</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>