<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/1494?offset=30</link>
	<atom:link href="https://bioinformaticsonline.com/related/1494?offset=30" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2727/download-mutliple-fasta-file-from-ncbi-in-one-go</guid>
	<pubDate>Wed, 21 Aug 2013 08:13:30 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2727/download-mutliple-fasta-file-from-ncbi-in-one-go</link>
	<title><![CDATA[Download mutliple fasta file from NCBI in one GO!!]]></title>
	<description><![CDATA[<p>if you have less time, then use three ways mentioned in bookmark link to extract/download all fasta sequences in single click given that you already have a list of GIs or accession IDs .</p>
<p>Alternatively, use one liner perl script:</p>
<p>perl -ne 'if(/^&gt;(\S+)/){$c=$i{$1}}$c?print:chomp;$i{$_}=1 if @ARGV' GIs.txt &gt;sequence.fasta</p>
<p>where GIs.txt contains&nbsp;a list of GIs or accession IDs.</p>
<p>(from :<a href="http://edwards.sdsu.edu/labsite/index.php/robert?start=5">http://edwards.sdsu.edu/labsite/index.php/robert?start=5</a>)</p><p>Address of the bookmark: <a href="http://edwards.sdsu.edu/labsite/index.php/robert/380-ncbi-sequence-or-fasta-batch-download-using-entrez" rel="nofollow">http://edwards.sdsu.edu/labsite/index.php/robert/380-ncbi-sequence-or-fasta-batch-download-using-entrez</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/33842/awesome-perl-frameworks-libraries-and-software-part-5</guid>
	<pubDate>Fri, 07 Jul 2017 04:12:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/33842/awesome-perl-frameworks-libraries-and-software-part-5</link>
	<title><![CDATA[Awesome perl frameworks, libraries and software - PART 5]]></title>
	<description><![CDATA[<ul>
<li><a href="https://github.com/robelix/sub2srt">robelix/sub2srt</a>&nbsp;- subtitle converter</li>
<li><a href="https://github.com/reyjrar/graphite-scripts">reyjrar/graphite-scripts</a>&nbsp;- A Collections of Scripts for Working with Graphite</li>
<li><a href="https://github.com/regilero/check_nginx_status">regilero/check_nginx_status</a>&nbsp;- Nagios check for nginx status report</li>
<li><a href="https://github.com/omniti-labs/resmon">omniti-labs/resmon</a>&nbsp;- resmon</li>
<li><a href="https://github.com/motemen/App-htmlcat">motemen/App-htmlcat</a>&nbsp;- redirect stdin to web browser</li>
<li><a href="https://github.com/moose/Moo">moose/Moo</a>&nbsp;- Minimalist Object Orientation (with Moose compatibility)</li>
<li><a href="https://github.com/miyagawa/fastpass">miyagawa/fastpass</a>&nbsp;- Tiny, XS free, standalone and preforking FastCGI daemon for PSGI</li>
<li><a href="https://github.com/miyagawa/Filesys-Notify-Simple">miyagawa/Filesys-Notify-Simple</a>&nbsp;- Simple and dumb file system watcher</li>
<li><a href="https://github.com/mhop/fhem-mirror">mhop/fhem-mirror</a>&nbsp;- Branch 'master' is a read-only-mirror of svn://svn.code.sf.net/p/fhem/code which is updated once a day. On branch 'enocean' I am going to add some Enocean-Devices</li>
<li><a href="https://github.com/lopnor/Plack-App-DAV">lopnor/Plack-App-DAV</a>&nbsp;- simple DAV server for Plack</li>
<li><a href="https://github.com/kazuho/url_compress">kazuho/url_compress</a>&nbsp;- a static PPM-based URL compressor / decompressor</li>
<li><a href="https://github.com/jnthn/6model">jnthn/6model</a>&nbsp;- Just a place that I'm keeping some meta-model prototyping; anything that matters will make it to another repo (e.g. nqp-rx one or Rakudo one) at some point.</li>
<li><a href="https://github.com/jasonhancock/nagios-puppetdb">jasonhancock/nagios-puppetdb</a>&nbsp;- Nagios plugins and pnp4nagios templates related to Puppetlab's PuppetDB project.</li>
<li><a href="https://github.com/goccy/p5-Compiler-Parser">goccy/p5-Compiler-Parser</a>&nbsp;- Create Abstract Syntax Tree for Perl5</li>
<li><a href="https://github.com/cgutteridge/Grinder">cgutteridge/Grinder</a>&nbsp;- Create RDF data from spreadsheets or CSV</li>
<li><a href="https://github.com/c9s/Plack-Middleware-OAuth">c9s/Plack-Middleware-OAuth</a>&nbsp;- Plack Middleware for OAuth1 and OAuth2</li>
<li><a href="https://github.com/bzip2-cuda/bzip2-cuda">bzip2-cuda/bzip2-cuda</a>&nbsp;- Parallel implementation of bzip2 using cuda</li>
<li><a href="https://github.com/alanstevens/ChocoPackages">alanstevens/ChocoPackages</a>&nbsp;- Chocolatey Nuget Packages</li>
<li><a href="https://github.com/SoylentNews/slashcode">SoylentNews/slashcode</a>&nbsp;- The slashcode repository for SoylentNews. The initial code base was uploaded as it appeared on Sourceforge as of the last commit in September 2009</li>
<li><a href="https://github.com/Miserlou/XSS-Harvest">Miserlou/XSS-Harvest</a>&nbsp;- XSS Weaponization</li>
</ul>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/36952/getoptspl-file</guid>
	<pubDate>Fri, 15 Jun 2018 04:43:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/36952/getoptspl-file</link>
	<title><![CDATA[getopts.pl file]]></title>
	<description><![CDATA[
<p>SSPACE_longread complain for getopts.pl file. </p>

<p>To resolve this, download and have in SSPACED-Longreads folder. </p>

<p>Cheers :)</p>
]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/36952" length="942" type="text/plain" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</guid>
	<pubDate>Fri, 12 Jul 2013 07:20:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</link>
	<title><![CDATA[How to install Perl modules manually, using CPAN command, and other quick ways]]></title>
	<description><![CDATA[<p>As a bioinformatics programmer, and crunchy data analyser you need to install several perl modules and dependencies. Installing Perl modules manually by resolving all the dependencies is&nbsp; tedious and annoying process. Some of the packages like GD is the real pain. <br /><br />However, Installing Perl modules using CPAN is a better solution, as it resolves all the dependencies automatically. In this article, let us review how to install Perl modules on Linux ( which is prefereced amonst bioinformatician) using both manual and CPAN method.<br /><br />When a Perl module is not installed, application will display the following error message. In this example, XML::Parser Perl module is missing.</p><p>Can't locate XML/parser.pm in @INC (@INC contains:<br />/usr/lib/perl5/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/5.10.0<br />/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi<br />/usr/local/lib/perl5/site_perl/5.10.0<br />/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl<br />/usr/lib/perl5/site_perl/5.10.0 .)</p><p><strong>Manual Method of Perl Module Installation</strong></p><ul>
<li>Install Perl Modules Manually</li>
</ul><p>This manual method is very useful when your computer or server is not connected to the Internet.</p><p>Download Perl module: <br />Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download<br /><br /># cd /home/download<br /># gzip -d XML-Parser-2.36.tar.gz<br /># tar xvf XML-Parser-2.36.tar<br /># cd XML-Parser-2.36<br /><br />Build the perl module: <br />Build by running Makefile.PL, remember the case sensitivity, make and make test.<br /><br /># perl Makefile.PL<br />Checking if your kit is complete...<br />Looks good<br />Writing Makefile for XML::Parser::Expat<br />Writing Makefile for XML::Parser<br /># make<br /># make test<br /><br />Install the perl module:<br />Now your package is ready to install.<br /><br /># make install<br /><br />As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.</p><p><strong>Install Perl Modules using CPAN automatically</strong></p><p>Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you&nbsp; are laughing, "to install a perl module you need another perl module"&nbsp; ;)<br /><br />Lets verify whether CPAN is already installed:<br /><br />To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.<br /><br /># cpan<br />-bash: cpan: command not found<br /><br /># perl -MCPAN -e shell<br />Can't locate CPAN.pm in @INC (@INC contains:<br />/usr/lib/perl5/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/5.10.0<br />/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi<br />/usr/local/lib/perl5/site_perl/5.10.0<br />/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/vendor_perl/5.10.0<br />/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).<br />BEGIN failed--compilation aborted.<br /><br />Install the CPAN module using yum:<br />If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :). <br /><br /># yum install perl-CPAN<br /><br />Output of yum install perl-CPAN command:</p><p>Loaded plugins: refresh-packagekit<br />updates-newkey&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 2.3 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />primary.sqlite.bz2&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 2.4 MB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />Setting up Install Process<br />Parsing package install arguments<br /><br />Resolving Dependencies<br />Transaction Summary<br />=============================================================================<br />Install&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5 Package(s)<br />Update&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0 Package(s)<br />Remove&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0 Package(s)<br /><br />Total download size: 1.0 M<br />Is this ok [y/N]: y<br />Downloading Packages:<br />(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp; |&nbsp; 30 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; |&nbsp; 70 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 217 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm&nbsp;&nbsp; | 284 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(5/5): perl-devel-5.10.0-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 408 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br /><br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-ExtUtils-ParseXS&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [1/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-devel&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [2/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-Test-Harness&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [3/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-ExtUtils-MakeMaker&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [4/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-CPAN&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [5/5]<br /><br /><br />Installed: perl-CPAN.i386 0:1.9205-31.fc9<br />Dependency Installed:<br />&nbsp; perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9<br />&nbsp; perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9<br />&nbsp; perl-Test-Harness.i386 0:2.64-31.fc9<br />&nbsp; perl-devel.i386 4:5.10.0-31.fc9<br />Complete!<br /><br />Configure cpan the first time:<br />Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.<br /><br />Note: Make sure to execute &ldquo;o conf commit&rdquo; in the cpan prompt after the configuration to save the settings.<br /><br /># cpan<br /><br />Sorry, we have to rerun the configuration dialog for CPAN.pm due<br />to some missing parameters...<br /><br />CPAN build and cache directory? [/root/.cpan]<br />Download target directory? [/root/.cpan/sources]<br />Directory where the build process takes place? [/root/.cpan/build]<br /><br />Always commit changes to config variables to disk? [no]<br />Cache size for build directory (in MB)? [100]<br />Let the index expire after how many days? [1]<br /><br />Perform cache scanning (atstart or never)? [atstart]<br />Cache metadata (yes/no)? [yes]<br />Policy on building prerequisites (follow, ask or ignore)? [ask]<br /><br />Parameters for the 'perl Makefile.PL' command? []<br />Parameters for the 'perl Build.PL' command? []<br /><br />Your ftp_proxy? []<br />Your http_proxy? []<br />Your no_proxy? []<br />Is it OK to try to connect to the Internet? [yes]<br /><br />First, pick a nearby continent and country by typing in the number(s)<br />(1) Africa<br />(2) Asia<br />(3) Central America<br />(4) Europe<br />(5) North America<br />(6) Oceania<br />(7) South America<br />Select your continent (or several nearby continents) [] 5<br /><br />(1) Bahamas<br />(2) Canada<br />(3) Mexico<br />(4) United States<br />Select your country (or several nearby countries) [] 4<br /><br />(2) ftp://carroll.cac.psu.edu/pub/CPAN/<br />(3) ftp://cpan-du.viaverio.com/pub/CPAN/<br />(4) ftp://cpan-sj.viaverio.com/pub/CPAN/<br />(5) ftp://cpan.calvin.edu/pub/CPAN<br />(6) ftp://cpan.cs.utah.edu/pub/CPAN/<br />e.g. '1 4 5' or '7 1-4 8' [] 2-16<br /><br />cpan[1]&gt; o conf commit<br />commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'<br /><br />cpan[2]&gt; quit<br />No history written (no histfile specified).<br />Lockfile removed.<br /><br /></p><ul>
<li>Install Perl Modules using CPAN</li>
</ul><p>Hey smile please, now you are ready with CPAN and can download modules in one line command. <br /><br />You can use one of the following method to install a Perl module using cpan:<br /><br /># perl -MCPAN -e 'install Bundle::BioPerl'<br /><br />(or)<br /><br /># cpan<br />cpan shell -- CPAN exploration and modules installation (v1.9205)<br />ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)<br /><br />cpan[1]&gt; install "Bundle::BioPerl"<br /><br />In the example above, CPAN will check for&nbsp;Bundle::BioPerl dependencies and automatically resolves and installs&nbsp;Bundle::BioPerl with all the dependent Perl modules.</p><ul>
<li>Quick Ways</li>
</ul><p>Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.</p><p># sudo apt-cache search perl BioPerl</p><p>Output will be like as follows:</p><p>bioperl - Perl tools for computational molecular biology<br />bioperl-run - BioPerl wrappers: scripts<br />libbio-perl-perl - BioPerl core perl modules<br />libbio-perl-run-perl - BioPerl wrappers: modules<br />libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing<br />libbiojava-java - Java API to biological data and applications (default version)<br />libbiojava3-java - Java API to biological data and applications (default version)<br />python-biopython-sql - Biopython support for the BioSQL database schema<br />libbtlib-perl - library for basic sequence manipulation<br /><br /></p><p># sudo apt-get install bioperl</p><p>If it is installed then flash the following message:</p><p>Reading package lists... Done<br />Building dependency tree&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />Reading state information... Done<br />bioperl is already the newest version.<br />0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.</p><p>In it is found not installed in your server or system them install all with dependencies.</p><p>You can use the same approach to install all the modules, and packages if required.</p><p>Thanks for reading. Best of luck for your research.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>

</channel>
</rss>