https://github.com/microsoftgenomics

Address of the bookmark: https://github.com/microsoftgenomics

More at http://www.nature.com/articles/srep24175

Address of the bookmark: https://sourceforge.net/projects/sb2nhri/files/MyCC/

https://academic.oup.com/bioinformatics/article/32/4/605/1744462/MaxBin-2-0-an-automated-binning-algorithm-to

The most recent version of MaxBin is 2.2, which supports the analysis of coassemblies of multiple samples. It is available at this JBEI downloads sites as well as MaxBin and MaxBin 2.0 sourceforge sites.

Address of the bookmark: http://downloads.jbei.org/data/microbial_communities/MaxBin/MaxBin.html

GroopM is largely parameter-free. Use: groopm -h for more info.

For installation and usage instructions see : http://ecogenomics.github.io/GroopM/

Address of the bookmark: https://github.com/ecogenomics/GroopM

JSON is built on two structures:

• A collection of name/value pairs. In various languages, this is realized as an object, record, struct, dictionary, hash table, keyed list, or associative array.
• An ordered list of values. In most languages, this is realized as an array, vector, list, or sequence.

These are universal data structures. Virtually all modern programming languages support them in one form or another. It makes sense that a data format that is interchangeable with programming languages also be based on these structures.

Address of the bookmark: http://json.org/

Address of the bookmark: https://chunlab.wordpress.com/tetra-nucleotide-analysis/

Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.

NCBI has developed an automatic prokaryotic genome annotation pipeline that combines ab initio gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP; see Pubmed Article) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume. You can find a more detailed description of the new version of the pipeline in NCBI Handbook chapter. NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.

https://www.ncbi.nlm.nih.gov/genome/annotation_prok/

Address of the bookmark: https://www.ncbi.nlm.nih.gov/genome/annotation_prok/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

https://bio7.org/about/

Address of the bookmark: https://bio7.org/home-2/

1. Heatmaps: Exploring Patterns in High-Dimensional Data

Heatmaps are a go-to visualization for representing high-dimensional datasets, such as gene expression or metabolomics data. They use color gradients to display data intensity, making patterns and clusters easily detectable.

• Applications: Gene expression analysis, pathway enrichment, methylation studies.

• Tools: Seaborn (Python), ComplexHeatmap (R), Morpheus (web-based).

Tip: Add dendrograms to visualize clustering of rows and columns for hierarchical relationships.

2. Volcano Plots: Highlighting Differential Features

Volcano plots are indispensable for identifying significantly differentially expressed genes or proteins. They plot the log2 fold change against –log10(p-value), making it easy to spot statistically significant changes.

• Applications: RNA-seq, proteomics, and metabolomics.

• Tools: ggplot2 (R), EnhancedVolcano (R), Plotly (Python).

Tip: Use color to highlight significant features and label key genes or proteins.

3. PCA Plots: Reducing Complexity with Principal Component Analysis

Principal Component Analysis (PCA) plots are used to reduce dimensionality and uncover trends or clusters in data. They provide insights into sample variability and grouping.

• Applications: Transcriptomics, metabolomics, microbiome studies.

• Tools: scikit-learn + Matplotlib (Python), prcomp (R), ClustVis (web-based).

Tip: Annotate clusters with metadata to enhance interpretability.

4. Manhattan Plots: Genome-Wide Association Studies

Manhattan plots visualize p-values across the genome, making it easy to identify significant associations in genome-wide studies. They resemble city skylines, with the highest peaks indicating loci of interest.

• Applications: GWAS, QTL mapping.

• Tools: qqman (R), Matplotlib (Python).

Tip: Use alternating colors for chromosomes and highlight significant SNPs for clarity.

5. Circular Plots (Circos): Visualizing Genomic Relationships

Circular plots are ideal for visualizing relationships across the genome, such as structural variations, gene duplications, or synteny.

• Applications: Comparative genomics, structural variation studies.

• Tools: Circos (standalone), Rcircos (R), pyCircos (Python).

Tip: Keep the plot clean and avoid overcrowding to maintain readability.

6. Sankey Diagrams: Tracking Data Flows

Sankey diagrams visualize flows or relationships between categories, often used to track changes in gene expression or pathway enrichment across conditions.

• Applications: Pathway analysis, gene set enrichment analysis.

• Tools: Plotly (Python), networkD3 (R).

Tip: Use gradients or distinct colors to highlight key transitions.

7. Network Graphs: Mapping Interactions

Network graphs represent relationships between entities, such as protein-protein interactions or gene regulatory networks. Nodes represent entities, and edges represent relationships.

• Applications: Systems biology, interactomics.

• Tools: Cytoscape (standalone), igraph (R), NetworkX (Python).

Tip: Use edge thickness or node size to represent interaction strength or centrality.

8. Violin Plots: Visualizing Data Distribution

Violin plots combine a boxplot with a density plot, showing the distribution and variability of data.

• Applications: Single-cell RNA-seq, quantitative trait analysis.

• Tools: Seaborn (Python), ggplot2 (R).

Tip: Split violins by groups for side-by-side comparisons.

9. Time-Series Plots: Monitoring Changes Over Time

Time-series plots display changes in variables across time points, useful for tracking gene expression dynamics or metabolic fluxes.

• Applications: Time-course experiments, cell cycle studies.

• Tools: Matplotlib (Python), ggplot2 (R).

Tip: Smooth the data to highlight trends while avoiding overfitting.

10. Genome Tracks: Visualizing Genomic Features

Genome tracks display multiple layers of genomic data, such as gene annotations, sequencing coverage, and epigenetic marks.

• Applications: ChIP-seq, ATAC-seq, whole-genome sequencing.

• Tools: IGV (standalone), pyGenomeTracks (Python).

Tip: Stack related tracks for direct comparisons.

11. UpSet Plots: Visualizing Set Intersections

UpSet plots are a powerful alternative to Venn diagrams for visualizing intersections between multiple datasets.

• Applications: Overlap analysis for gene sets, pathways, or variants.

• Tools: UpSetR (R), ComplexUpset (Python).

Tip: Use bar plots to represent the size of each intersection for added clarity.

12. Ridge Plots: Comparing Distributions

Ridge plots visualize the distributions of multiple datasets, stacked for easy comparison.

• Applications: Transcriptomics, single-cell RNA-seq.

• Tools: ggridges (R), Matplotlib (Python).

Tip: Use transparency and consistent scaling for better readability.

13. Chord Diagrams: Visualizing Connections Between Groups

Chord diagrams illustrate relationships between categories, such as shared genes between pathways or overlaps in regulatory elements.

• Applications: Pathway overlap, synteny, co-expression networks.

• Tools: Circlize (R), Holoviews (Python).

Tip: Use distinct colors for each group to emphasize relationships.

14. Treemaps: Hierarchical Data Representation

Treemaps visualize hierarchical data as nested rectangles, with area proportional to data size.

• Applications: Ontology enrichment, pathway analysis.

• Tools: Treemapify (R), Plotly (Python).

Tip: Use colors to represent additional variables, like significance or enrichment scores.

15. T-SNE/UMAP Plots: Dimensionality Reduction for Clustering

T-SNE and UMAP plots are great for visualizing high-dimensional data in two dimensions while preserving local or global structure.

• Applications: Single-cell transcriptomics, clustering analyses.

• Tools: scikit-learn (Python), Seurat (R).

Tip: Combine with metadata annotations for better cluster interpretation.

Bringing It All Together

The choice of visualization can significantly impact the insights gained from bioinformatics data. By selecting plots tailored to your data type and analysis goals, you can effectively communicate your findings and make your research more impactful. Whether you’re a seasoned bioinformatician or a beginner, mastering these visualizations will elevate your analyses and presentations.