1. SPAdes: An assembler specifically designed for single-cell and multi-cell bacterial genomes, as well as small eukaryotic genomes.

2. ABySS: A parallelized assembler for large genomes that uses de Bruijn graphs.

3. Velvet: Another de Bruijn graph-based assembler optimized for short-read sequencing data.

4. SOAPdenovo: A de Bruijn graph-based assembler designed for short reads, widely used for assembling large and complex genomes.

5. MaSuRCA: A hybrid assembler that combines data from multiple sequencing technologies, such as Illumina and PacBio.

6. Canu: A long-read assembler optimized for PacBio and Oxford Nanopore sequencing data.

7. Flye: A long-read assembler suitable for bacterial and small eukaryotic genomes.

8. SMARTdenovo: An assembler designed for long reads, particularly suited for PacBio data.

9. SPAdes Long Read (SPAdesLR): An extension of SPAdes for long-read data, such as those from PacBio or Nanopore.

10. Minia: An assembler optimized for low memory consumption, suitable for small and medium-sized genomes.

11. Unicycler: A hybrid assembler that combines short and long reads for circular bacterial genome assembly.

12. wtdbg2: A de Bruijn graph assembler for long reads, efficient for very large genomes.

13. Shasta: A long-read assembler that uses the Overlap-Layout-Consensus approach, suitable for PacBio and Nanopore data.

14. Sparc: An assembler designed to handle noisy long reads from Nanopore sequencing.

15. CANA: An assembler for metagenomic data, particularly for complex and diverse microbial communities.

16. Ra Assembler: A metagenome assembler for long reads, designed for highly complex metagenomic samples.

Please note that the field of bioinformatics is constantly evolving, and new assembly tools may have emerged since my last update. Additionally, the performance of these tools can vary depending on the characteristics of the sequencing data and the genome being assembled. When selecting an assembly tool, consider the specific requirements of your project, the available data types, and the computational resources at your disposal. Always refer to the respective tool's documentation and publications for the most up-to-date information and recommendations.

Why Bioinformatics Matters More Than Ever

Every day, our world generates massive amounts of biological data—from genome sequences to microbiome profiles to real-time pathogen surveillance. Hidden within these datasets are the answers to some of the greatest challenges humanity faces: emerging diseases, antimicrobial resistance, environmental stress, genetic disorders, sustainable agriculture, and more.

Bioinformatics isn’t just a skill.
It’s the language of the future of biology.

By mastering it, you give yourself the power to:

Decode genomes and understand life at its most fundamental level

Identify patterns no microscope could ever reveal

Predict disease outbreaks before they occur

Accelerate drug discovery with computational precision

Contribute to open-source tools that empower scientists worldwide

You don’t just follow science—you drive it.

Every Expert Was Once a Beginner

Many newcomers feel intimidated. Command-line interfaces. R scripts. Python packages. Next-generation sequencing data. Complex machine learning models.

But here’s the truth: every bioinformatician started exactly where you are now—curious, unsure, but excited.

No one writes perfect code on day one.

No one understands genomics pipelines immediately.

What makes you a bioinformatician is not perfection, but perseverance.

When your script throws a cryptic error…
When your data refuses to format…
When your pipeline runs for 6 hours only to crash…

Remember: this is part of the journey.
Every error teaches you. Every retry strengthens you. Every breakthrough energizes you.

Bioinformatics Is Not Just a Career—It’s a Mindset

It’s the mindset of:

Problem-solving.

Continuous learning.

Turning chaos into clarity.

Seeing what others can’t.

Bioinformaticians are detectives of biological complexity. You sit at the intersection of innovation, using tools that can shape public health, medicine, agriculture, and ecology. Few fields give you such direct impact on the world.

Your Contribution Matters

As you work on your script, pipeline, genome, or model, remember:

Somewhere, your analysis might contribute to:

A new therapy

A faster diagnostic test

A better understanding of a pathogen

A more resilient crop

An open-source dataset that helps thousands

A discovery that rewrites textbooks

Your code may be small, but its ripple effect is powerful.

The Future Is Bioinformatics—And You Are Part of It

The world is shifting. Wet labs are integrating AI. Hospitals rely on genomic insights. Farmers use gene-level predictions. Governments monitor disease in real time. Students launch pipelines that become global tools.

This is a golden era—and you are not late.
You are exactly where you need to be.

Keep Pushing. Keep Learning. Keep Discovering.

Bioinformatics is a journey filled with challenges, but also with unmatched rewards.

So the next time you feel stuck, frustrated, or overwhelmed, remember:
You’re building the science of tomorrow.

Be proud. Stay curious. Keep going.
Your work matters more than you think.

More at http://www.doc.ic.ac.uk/~natasha/index.html

NEW DELHI-110067

Applications are invited for the position of Research Associate (RA) for the following time-bound sponsored project as per the details given below:

1. BTIS project entitled, “National Infrastructural Facility in the Area of Immunology” funded by DBT

Research Associate (One Position only)

Dr. Debasisa Mohanty Staff Scientist-VI deb@nii.res.in

Educational Qualifications: Ph.D in Bioinformatics or Biological Sciences or Biotechnology with research experience and publication record in indexed peer reviewed journals in the area of bioinformatics or computational biology.

Emoluments: The selected candidates will draw consolidated emoluments as per Institute Rules, depending upon qualifications & experience Research Associate: Rs. 36,000/- per month plus 30% HRA

Job description & Desired Knowledge: The candidate should be well versed in Programming in PERL/C++, HTML, CGI, web sever and portal development, computational analysis of protein structure & function, molecular dynamics simulations and use of high performance computing systems.

General Terms & Conditions:-

1. The candidates selected for the above posts will be on contract for one year or duration of the project whichever is shorter, at a time.

2. No hostel/ housing facility will be provided.

3. Applicants may clearly mention the category they belong to i.e. SC/ST/OBC/PH and attach documentary proof of the same.

4. No TA/DA will be paid for attending the interview, if called for.

5. Apart from sending application in the prescribed format given below, candidates should send complete Curriculum Vitae along with the names of three referees. Curriculum Vitae should contain details of the experimental expertise and list of publications. 6. Canvassing in any form will be a disqualification.

HOW TO APPLY Interested candidates may apply directly, STRICTLY IN THE PRESCRIBED FORMAT GIVEN BELOW, through e-mail, to the Investigator of the project, clearly indicating the name of the project along with their complete C.V., Email ID, fax numbers, telephone numbers. Only Short listed candidates will be called for interview and they required to submit attested copies of all their certificates and a Demand Draft of Rs 100/- drawn on Canara Bank or Indian Bank payable at Delhi/New Delhi in favour of the Director, NII (SC/ST/PH and Women candidates are exempted from payment of fees) subject to submission of documentary proof), at the time of interview. (E-MAIL APPLICATIONS SHOULD MENTION BTIS-RA 2015 IN THE SUBJECT LINE)

LAST DATE OF RECEIPT OF APPLICATIONS: 29th October, 2015

Advertisement:

www1.nii.res.in/sites/default/files/projectappointments-Dr.Mohanty-29oct2015.pdf

A manual can be found here.

Address of the bookmark: https://www.zbh.uni-hamburg.de/forschung/arbeitsgruppe-genominformatik/software/tallymer.html

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

https://f1000research.com/articles/6-100/

https://github.com/jason-weirather/AlignQC

Address of the bookmark: https://www.healthcare.uiowa.edu/labs/au/AlignQC/

WALK -IN- TEST CUM INTERVIEW

Walk- in- Test cum Interview (based on test) for the selection of Research Associate (Bioinformatics) & Bioinformatic Trainees under the scheme ‘Distributed Information Sub Centre- DISC’ will be held at this Institute as per details indicated below.

Research Associate

Date of Interview : 21 -01-2014 at 10.00 A.M

Qualifications : a) Essential: Doctorate degree in Bioinformatics or Biotechnology/Life Sciences/Biochemistry with expertise in Bioinformatics as evidenced by publications.

OR

Three years research experience after MVSc/MPharm/ME/MTech with Bioinformatics Specialization.

b Desirable: Experience in handling NGS data Programming skills in Python/Bioperl

Emoluments : Rs:22000/- per month + HRA (higher pay upto Rs.24000/- can be paid depending on the qualifications and experience.

Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)

Duration of Project : Till the closure of the project.

General Terms and conditions

1. The above positions are purely on temporary basis and is co-terminus with the closure of the project. There is no provision of re-employment after termination of project. The selected candidate will not have any right for claiming pay scale or absorption against any regular post being vacant on a later date at this Institute.
2 . No TA/DA will be paid for attending the Interview.
3. Canvassing in any form will lead to cancellation of candidate.
4. The decision of Director, IISR would be final and binding in all aspects.
5. Candidates will not be permitted to enter the Examination Hall after 10.00 A.M.
6. Candidates who secure the minimum marks prescribed by the Institute in written test only will be eligible for calling for the interview. The number of candidates to be called for the interview will be decided by the Director of the Institute.
7 Those who do not possess original Degree/PG certificate or Provisional certificate will not be allowed to attend the Test/Interview.

Note: All relevant certificates (in original) and bio data
No objection certificate in case he/she is employed elsewhere and experience certificate in original (if any) need to be produced at the time of interview.
Location of IISR Kozhikode Main Campus - Pallithazham bus stop between Moozhikkal East and Chelavoor on the NH 212 ”Kozhikode - Kollegal” Road.

Advertisement: www.spices.res.in/pdf/DISC-Website.pdf