Lab page @ http://graveleylab.cam.uchc.edu/Graveley/index.html

We work in a highly interdisciplinary environment at the interface of Computer Science and Biology. Since its inception, our lab has eagerly engaged in collaborative research partnerships with biological and experimental collaborators, facilitated by our affiliation with the Broad Institute and the Computational and Systems Biology initiative (CSBi) at MIT, our participation in the Epigenome Roadmap, ENCODE, and modENCODE consortia, and by several other ongoing collaborations at MIT, Harvard, and the Harvard Medical School affiliated hospitals.

http://compbio.mit.edu/

The bpRNA code is written in perl and requires the Graph perl module. Several additional scripts for analysis are included. The source code is available at http://github.com/hendrixlab/bpRNA.

Address of the bookmark: http://github.com/hendrixlab/bpRNA

CPAT - https://github.com/liguowang/cpat, http://lilab.research.bcm.edu/ (web server)

CPC2 - https://github.com/gao-lab/CPC2_standalone, http://cpc2.gao-lab.org/ (web server)

Infernal - http://eddylab.org/infernal/, https://github.com/EddyRivasLab/infernal

NCBI RefSeq - https://www.ncbi.nlm.nih.gov/refseq/

Rfam - http://rfam.xfam.org/, https://docs.rfam.org/en/latest/index.html

SILVA - https://www.arb-silva.de/

RNAmmer - http://www.cbs.dtu.dk/services/RNAmmer/ (web server, standalone download link)

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

The manual translation of many, frequently rather complex SPSS scripts often presents itself as a tedious and error-prone task, and represents a rather large obstacle for many analysts and companies to migrate to a modern, open source data management and analysis tool like R. With translate2R this hurdle will be diminished substantially.

Find at https://service.eoda.de/translater/?lang=en

Since this is your first time here, I suggest starting with something simple like Fizz Buzz.

Address of the bookmark: https://code.golf/

Welcome to phylobabble.org, a discussion forum for phylogenetic theory and applications. The primary goal of this forum is to discuss best practice and new developments in phylogenetics. Although we do have a Troubleshooting category for getting feedback on analyses, this is not a help site for running phylogenetics programs.

A great place to chat about phylogenetics for researchers and the broader community of students and science-interested citizens. 

Address of the bookmark: http://phylobabble.org/

01. Scientist II 01
Essential: Ph.D. degree in Life Sciences from a recognized university along with a minimum of 2 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

OR
Ph.D. degree in Bioinformatics from a recognized university.

OR
M.Sc. in Bioinformatics from a recognized university along with a minimum of 3 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

Desirable:
Thorough Knowledge about In silico genome analysis and comparative genomics.
Experience with in silico identification of novel virulence factors of pathogens, host-pathogen interactions and Systems Biology.
Additional Postdoctoral research experience in relevant subjects from a recognized institutions.

Rs. 44,000/- p.m. (consolidated) plus 30% HRA

Below 40 years

Applications along with Bio-Data containing detail work experience and full list of publications may be sent via email tosantasabujdas@yahoo.com latest by October 27, 2014.

Short-listed candidates will be called via email for an interview to be held at the institute in the second week of November, 2014.

Advertisement: www.niced.org.in/placements.htm