BOL: Related items

Zhang Lab

Sun, 28 Dec 2014 12:43:08 -0600

We develop and use integrative bioinformatics approaches to extract biological meanings from experimental data and generate hypotheses for experimental validation. Please explore our website to learn more about our people and our research.

More at http://bioinfo.vanderbilt.edu/zhanglab/

Type Hinting

Pranjali Yadav — Fri, 09 Jan 2015 22:26:13 -0600

Python creator Guido van Rossum’s proposal for static type-checking annotations is inching closer to reality, and the feature has taken on a new name: type hinting.

Back in August, van Rossum published a proposal on the Python mailing list recommending type-checking annotations as a valuable feature for the next version of Python to improve the performance of editors and IDEs, linter capabilities, standard notation, and refactoring. Van Rossum’s latest proposal, posted late last month, outlined plans to publish a Python Enhancement Proposal (PEP) in early January to put the feature now known as type hinting on track for inclusion in Python 3.5, slated for release this September.

Reference

https://quip.com/r69HA9GhGa7J

Linux operating system aimed at scientists

Pranjali Yadav — Mon, 19 Jan 2015 08:30:49 -0600

The Bio-Linux operating system is based on Ubuntu 14.04 LTS (Trusty Tahr), and the previous version was using Ubuntu 12.04 LTS. The developers only use LTS releases and that means that upgrades for this distro don't come along all that often.

This Linux distribution is aimed at scientists and it comes with more than 250 bioinformatics packages, 50 graphical applications and several hundred command line tools. And this is just skimming the surface of what the OS can do. Users have access to even more apps from the official repositories.

Bio-Linux is using an Ubuntu LTS version as its base

The fact that it uses Ubuntu LTS versions for the base is a good thing because it means its users won't have to worry about the support. Ubuntu 14.04 LTS is supported until 2019, so people who are using Bio-Linux shouldn't have a problem.

"An updated Bio-Linux 8 version is now on the website in ISO and OVA versions. As usual, there is no need to download this version if you are an existing user. All updates to existing packages will be applied to your system through the update manager and new packages are all available via apt-get or Synaptic," reads the announcement.

The changelog also states that a problem that was preventing the desktop to not start on VirtualBox has been fixed, the QIIME and Bowtie-Bio tools have been upgraded, the pandaseq paired end assembler has been added, and the beginners tutorial specific to Bio-Linux 8 has been improved.

Check out the official announcement for a complete list of changes and updates. You can download Bio-Linux 8.0.5 right now from Softpedia and give it a spin. It has the Unity desktop and now it runs very well in virtual environments.

Reference @ http://news.softpedia.com/news/Bioinformatics-Distro-Bio-Linux-8-0-5-Now-Available-for-Download-469867.shtml

JRF/RA Structural/Computational Biology at ICGEB

Thu, 29 Jan 2015 11:52:40 -0600

Research Associate and JRF positions in the Structural and Computational Biology Group starting 1st March 2015. Collaborative projects include work on:

a) bioinformatics, systems and computational biology
b) malaria
c) drug discovery
d) genomics
e) microbiology
f) metabolic disorders
g) molecular medicine

Eligibility: Applicants must have one of the following :

1) INSPIRE award for undertakig either PhD or Postdoctoral research;
2) SPM award for PhD;
3) JRF for pursuing PhD from CSIR/DBT/ICMR

Interest and experience in Biochemistry/Bioinformatics/Biophysics/ Chemistry/Genomics/Molecular Biology/ is essential.

Submit curriculum vitae to sb.icgeb@gmail.com by 20 February 2015

RA / Research Associate Bioinformatics/Computational Biologist

Thu, 26 Feb 2015 03:44:24 -0600

The following posts are urgently required to be filled for the Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" administrated by Prof Indira Ghosh, School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067

RA / Research Associate (Bioinformatics/Computational Biologist)
Salary: Rs. 23000/- + HRA
Vacancy: 1
Essential Qualifications: PhD, preferably in plant biotechnology/biochemistry/Bioinformatics with experience in analyzing high throughput omics-based data. Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, managing the project portal, preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.

Address: Prof Indira Ghosh, room #12 Project Investigator, (Core Metabolomics) School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067.

Apply Details
Last Date: March 3rd 2015
Web/Notification URL http://www.jnu.ac.in/Career/currentjobs. htm

BINC 2015 !!!

Rahul Nayak — Sat, 11 Apr 2015 20:35:27 -0500

Pondicherry University,Puducherry,on behalf of Department of Biotechnology, Government of India, will conduct the BINC examination in2015. The objective of this examination is to certify bioinformatics professionals, trained formally as well as self-trained.Registration will open from March 9,2015 to April 30,2015. Pondicherry University, Puducherry has been identified as a nodal agency by the Department of Biotechnology, Govt. of India to coordinate this examination along with nine centres namely, Pune University, Pune; Anna University, Chennai; Calcutta University, Kolkata; Institute of Bioinformatics & Applied Biotechnology, Bangalore; North-Eastern Hill University, Shillong, University of Hyderabad, Hyderabad; University of Kerala, Thiruvananthapuram; Jawaharlal Nehru University, New Delhi and Assam Agricultural University, Guwahati. In the BINC 2013 examination,17 candidates were certified. DBT has agreed to fund Research fellowships for all the BINC qualified Indian nationals to pursue Ph.D. in Indian Institutes/Universities. Note that the candidate must possess a postgraduate degree(or equivalent) & meet the criteria of the institutes/universities in order to avail research fellowship. In addition, cash prize of Rs. 10,000/- will be awarded to the top 10 BINC qualifiers.

More at http://www.binc.co.in/College/Index_New.aspx

BINC notification http://www.binc.co.in/PdfDocuments/Notification.pdf

Few dates to remember:

Starting of online submission of application: March 9, 2015
Last date for submission of application: April 30,2015
Examination consists of two parts:
Part I (Paper I) : June 7, 2015 (10 AM-12 PM)
Part II ( Paper II & III) :June 28, 2015 (9 AM-12 PM & 2 PM-4 PM)

BINC Sample Question Paper !!!

Jitendra Narayan — Thu, 16 Apr 2015 09:16:18 -0500

BINC sample question paper. Wish you all the best for BINC examination.

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Ensembl 27

Jit — Tue, 16 Jun 2015 16:10:36 -0500

What is new?

Expansion of Protists and Fungi with hundreds of annotated genomes
Variation data for bread wheat, rice, Aedes aegypti, and Ixodes scapularis
Whole genome alignments for O. longistaminata and T. cacao
Non-coding RNA gene models in Bacteria
New assembly of tomato (version 2.50)
Full support for UCSC Track Hub format for hosting your own data in Ensembl

More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/