Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

• Expansion of Protists and Fungi with hundreds of annotated genomes
• Variation data for bread wheat, rice, Aedes aegypti, and Ixodes scapularis
• Whole genome alignments for O. longistaminata and T. cacao
• Non-coding RNA gene models in Bacteria
• New assembly of tomato (version 2.50)
• Full support for UCSC Track Hub format for hosting your own data in Ensembl

More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/

Bioinformatics supports to researchers
Customized training in Bioinformatics for researchers and faculty members
Support in Installing, implementing and maintaining software on computer.
Create awareness for taking preventive measure against data security
Organize workshops on thrust ares of Bioinformatics
Research Training to students of Biotechnology and Bioinformatics

More at http://bioinfo.bisr.res.in/index.php

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

NEW DELHI-110067

Applications are invited for the position of Research Associate (RA) for the following time-bound sponsored project as per the details given below:

1. BTIS project entitled, “National Infrastructural Facility in the Area of Immunology” funded by DBT

Research Associate (One Position only)

Dr. Debasisa Mohanty Staff Scientist-VI deb@nii.res.in

Educational Qualifications: Ph.D in Bioinformatics or Biological Sciences or Biotechnology with research experience and publication record in indexed peer reviewed journals in the area of bioinformatics or computational biology.

Emoluments: The selected candidates will draw consolidated emoluments as per Institute Rules, depending upon qualifications & experience Research Associate: Rs. 36,000/- per month plus 30% HRA

Job description & Desired Knowledge: The candidate should be well versed in Programming in PERL/C++, HTML, CGI, web sever and portal development, computational analysis of protein structure & function, molecular dynamics simulations and use of high performance computing systems.

General Terms & Conditions:-

1. The candidates selected for the above posts will be on contract for one year or duration of the project whichever is shorter, at a time.

2. No hostel/ housing facility will be provided.

3. Applicants may clearly mention the category they belong to i.e. SC/ST/OBC/PH and attach documentary proof of the same.

4. No TA/DA will be paid for attending the interview, if called for.

5. Apart from sending application in the prescribed format given below, candidates should send complete Curriculum Vitae along with the names of three referees. Curriculum Vitae should contain details of the experimental expertise and list of publications. 6. Canvassing in any form will be a disqualification.

HOW TO APPLY Interested candidates may apply directly, STRICTLY IN THE PRESCRIBED FORMAT GIVEN BELOW, through e-mail, to the Investigator of the project, clearly indicating the name of the project along with their complete C.V., Email ID, fax numbers, telephone numbers. Only Short listed candidates will be called for interview and they required to submit attested copies of all their certificates and a Demand Draft of Rs 100/- drawn on Canara Bank or Indian Bank payable at Delhi/New Delhi in favour of the Director, NII (SC/ST/PH and Women candidates are exempted from payment of fees) subject to submission of documentary proof), at the time of interview. (E-MAIL APPLICATIONS SHOULD MENTION BTIS-RA 2015 IN THE SUBJECT LINE)

LAST DATE OF RECEIPT OF APPLICATIONS: 29th October, 2015

Advertisement:

www1.nii.res.in/sites/default/files/projectappointments-Dr.Mohanty-29oct2015.pdf

More at http://busco.ezlab.org/

Address of the bookmark: http://busco.ezlab.org/

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.

More at http://crossmap.sourceforge.net/

Address of the bookmark: http://crossmap.sourceforge.net/

More at https://bitbucket.org/dranew/destruct

Address of the bookmark: https://bitbucket.org/dranew/destruct

Bhubaneswar 751023

Advt No. 07/2016

Institute of Life Sciences (ILS), Bhubaneswar, an autonomous Institute of the Department of Biotechnology, Ministry of Science & Technology, Government of India engaged in advanced research invites applications from Indian nationals for the Ph.D. program. The main focus of the projects will be computational biology in the following areas.

S. No. Area of Research Principal investigator

1. Computational Cancer Biology Dr. Anshuman Dixit

2. Immunogenomics & Systems Biology Dr. Sunil Kumar Raghav

3. Chromatin remodeling and hematopoiesis Dr. Punit Prasad

Candidates are strongly encouraged to visit ILS webpage for detailed information, regarding the research activities of the above mentioned scientists.

Essential Qualifications:

(a) Eligibility: M.Sc., M.V.Sc., M.Pharm., M.S. Pharma. (with NET/GATE/GPAT/BINC/any other equivalent national level exam) or M.Tech with minimum of 60% marks (or equivalent grade point). Those awaiting final result may also apply.

Applications received after the last date will not be accepted. The envelope should clearly be superscribed with “Application for Ph.D. program (computational biology)”. Short-listed candidates selected for the interview will be published in the Institute website (www.ils.res.in).

Application Fees: Applicants except SC/ST candidates are required to send a non-refundable D.D. for Rs.100/- in favour of “Director, Institute of Life Sciences, Bhubaneswar” payable at Bhubaneswar along with duly filled-in application form by the date mentioned below. Director, ILS reserves the right to withdraw the procedure without assigning any reasons thereof.

Important dates: 

Last date of receiving applications: 24th June 2016 

Date of display of short-listed candidates and instructions on the Institute website: 30th June 2016 

Date of interview: The interview will be organized on 25th July 2016

Advertisement: https://www.ils.res.in/wp-content/uploads/2016/05/advt07-16.pdf