Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

➜ cd trinityrnaseq-Trinity-v2.6.6

➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make
Using gnu compiler for Inchworm and Chrysalis
cd Inchworm && (test -e configure || autoreconf) \
&& sh ./configure --prefix=`pwd` && make install
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking whether the C++ compiler works... yes
checking for C++ compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
Making install in src
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp
mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp
mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp
mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp
mv -f .deps/IRKE.Tpo .deps/IRKE.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp
mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp
mv -f .deps/string_util.Tpo .deps/string_util.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp
mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp
mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp
mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp
mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp
mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp
mv -f .deps/Cigar.Tpo .deps/Cigar.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp
mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector >, int, bool, ArgProcessor)’:
FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (seq_region.size() < kmer_length) { continue; } // can be e
^
mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp
mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&, std::__cxx11::string&)’:
fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]
unsigned int kmer_length = kcounter.get_kmer_length();
^
mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"
/usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Nothing to be done for 'install-exec-am'.
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
cd Chrysalis && make UNSUPPORTED=yes
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator<(const makefile_builder::dependency&) const’:
./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
dependent_ == other.dependent_ &&
^
./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator<(const makefile_builder::subdir_and_target&) const’:
./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
subdir_ == other.subdir_ &&
^
./MakeDepend.cc: In function ‘int main(int, char**)’:
./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
char * options = "Ad:g:u:fh";
^
./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&)’:
./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
if ( ! this->FileIsSource( dependent ) && ! this->FileIsHeader( dependent
^
./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
this->FileIsHeader( dependent ) && this->FileIsSource( provider ) )
^
./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&) const’:
./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
return ( filename.size() > 2 &&
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:04 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:06 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o
./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:
./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < left_extensions.size(); i++) {
^
./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < right_extensions.size(); j++) {
^
./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’:
./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < adjacent_kmers.size(); i++) {
^
./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (kmer_extension_chars.size() == flank_extension_length) {
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:30 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o
./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]
if (_base_to_int[c] > 3)
^
./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]
int val = _base_to_int[c];
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:31 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o
/bin/rm -f lib_BubbleUpClustering_temp.a
ar -qc lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./BubbleUpClustering
g++ -ggdb3 -fopenmp -o ./BubbleUpClustering obj/analysis/BubbleUpClustering.o -L. -lm -pthread -l_BubbleUpClustering_temp
/bin/rm lib_BubbleUpClustering_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:32 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o
./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:
./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(command.c_str());
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:35 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o
./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&, FILE*, int, bool)’:
./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<=d.isize()-k; i++) {
^
/bin/rm -f lib_Chrysalis_temp.a
ar -qc lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./Chrysalis
g++ -ggdb3 -fopenmp -o ./Chrysalis obj/analysis/Chrysalis.o -L. -lm -pthread -l_Chrysalis_temp
/bin/rm lib_Chrysalis_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:39 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o
/bin/rm -f lib_CreateIwormFastaBundle_temp.a
ar -qc lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./CreateIwormFastaBundle
g++ -ggdb3 -fopenmp -o ./CreateIwormFastaBundle obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread -l_CreateIwormFastaBundle_temp
/bin/rm lib_CreateIwormFastaBundle_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:42 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o
./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&)’:
./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
&&
^
./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map<int, Pool>&, std::map&)’:
./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < adjacent_nodes.size(); j++) {
^
./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:
./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i bubble_up_cluster_growth(std::map&, std::map&)’:
./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&, vecDNAVector&)’:
./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t i = 0; i < p.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:
./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {
^
./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<clustered_pools.isize(); i++) {
^
./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
/bin/rm -f lib_GraphFromFasta_MPI_temp.a
ar -qc lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./GraphFromFasta_MPI
g++ -ggdb3 -fopenmp -o ./GraphFromFasta_MPI obj/GraphFromFasta_MPI.o -L. -lm -pthread -l_GraphFromFasta_MPI_temp
/bin/rm lib_GraphFromFasta_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:53 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o
./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:
./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matchesLeft.isize(); j++) {
^
./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matches.isize(); j++) {
^
/bin/rm -f lib_IsoformAugment_temp.a
ar -qc lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./IsoformAugment
g++ -ggdb3 -fopenmp -o ./IsoformAugment obj/analysis/IsoformAugment.o -L. -lm -pthread -l_IsoformAugment_temp
/bin/rm lib_IsoformAugment_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:56 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o
./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
/bin/rm -f lib_JoinTransByPairs_temp.a
ar -qc lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./JoinTransByPairs
g++ -ggdb3 -fopenmp -o ./JoinTransByPairs obj/analysis/JoinTransByPairs.o -L. -lm -pthread -l_JoinTransByPairs_temp
/bin/rm lib_JoinTransByPairs_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:00 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o
/bin/rm -f lib_QuantifyGraph_temp.a
ar -qc lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./QuantifyGraph
g++ -ggdb3 -fopenmp -o ./QuantifyGraph obj/analysis/QuantifyGraph.o -L. -lm -pthread -l_QuantifyGraph_temp
/bin/rm lib_QuantifyGraph_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:03 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o
/bin/rm -f lib_ReadsToTranscripts_temp.a
ar -qc lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts obj/analysis/ReadsToTranscripts.o -L. -lm -pthread -l_ReadsToTranscripts_temp
/bin/rm lib_ReadsToTranscripts_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o
/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a
ar -qc lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI obj/ReadsToTranscripts_MPI.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_temp
/bin/rm lib_ReadsToTranscripts_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:14 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o
/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a
ar -qc lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI_chang
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI_chang obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_chang_temp
/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:18 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o
./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:
./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(rm.c_str());
^
./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:
./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
/bin/rm -f lib_RunButterfly_temp.a
ar -qc lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./RunButterfly
g++ -ggdb3 -fopenmp -o ./RunButterfly obj/analysis/RunButterfly.o -L. -lm -pthread -l_RunButterfly_temp
/bin/rm lib_RunButterfly_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:23 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o
./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:
./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.lsize()-k; j++) {
^
./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int x=j; x<j+k; x++) {
^
/bin/rm -f lib_TranscriptomeFromVaryK_temp.a
ar -qc lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./TranscriptomeFromVaryK
g++ -ggdb3 -fopenmp -o ./TranscriptomeFromVaryK obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread -l_TranscriptomeFromVaryK_temp
/bin/rm lib_TranscriptomeFromVaryK_temp.a
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
cd trinity-plugins && make trinity_essentials
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
tar xvf seqtk-trinity.v0.0.2.tar.gz
seqtk-trinity-0.0.2/
seqtk-trinity-0.0.2/.gitignore
seqtk-trinity-0.0.2/LICENSE
seqtk-trinity-0.0.2/Makefile
seqtk-trinity-0.0.2/README.md
seqtk-trinity-0.0.2/khash.h
seqtk-trinity-0.0.2/kseq.h
seqtk-trinity-0.0.2/seqtk.c
seqtk-trinity-0.0.2/testing/
seqtk-trinity-0.0.2/testing/newformat_1.fq
seqtk-trinity-0.0.2/testing/newformat_2.fq
seqtk-trinity-0.0.2/testing/oldformat_1.fq
seqtk-trinity-0.0.2/testing/oldformat_2.fq
cd seqtk-trinity-0.0.2 && make
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm
seqtk.c: In function ‘stk_comp’:
seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]
int la, lb, lc, na, nb, nc, cnt[11];
^
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.
tar -zxvf "ParaFly-0.1.0".tar.gz && \
cd "ParaFly-0.1.0" && sh ./configure --prefix=`pwd` && make install && \
cp bin/ParaFly ../BIN/
ParaFly-0.1.0/
ParaFly-0.1.0/LICENSE
ParaFly-0.1.0/Makefile
ParaFly-0.1.0/Makefile.am
ParaFly-0.1.0/Makefile.in
ParaFly-0.1.0/README.md
ParaFly-0.1.0/aclocal.m4
ParaFly-0.1.0/bin/
ParaFly-0.1.0/bin/ParaFly
ParaFly-0.1.0/config.h
ParaFly-0.1.0/config.h.in
ParaFly-0.1.0/config.log
ParaFly-0.1.0/config.status
ParaFly-0.1.0/configure
ParaFly-0.1.0/configure.ac
ParaFly-0.1.0/depcomp
ParaFly-0.1.0/install-sh
ParaFly-0.1.0/missing
ParaFly-0.1.0/src/
ParaFly-0.1.0/src/.deps/
ParaFly-0.1.0/src/.deps/ParaFly.Po
ParaFly-0.1.0/src/.deps/argProcessor.Po
ParaFly-0.1.0/src/Makefile
ParaFly-0.1.0/src/Makefile.am
ParaFly-0.1.0/src/Makefile.in
ParaFly-0.1.0/src/ParaFly.cpp
ParaFly-0.1.0/src/argProcessor.cpp
ParaFly-0.1.0/src/argProcessor.hpp
ParaFly-0.1.0/stamp-h1
ParaFly-0.1.0/test/
ParaFly-0.1.0/test/Makefile
ParaFly-0.1.0/test/cmds.txt
ParaFly-0.1.0/test/rand_exit.pl
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking for C++ compiler default output file name... a.out
checking whether the C++ compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
Making install in src
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp
mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -o ParaFly ParaFly.o argProcessor.o
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"
/usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Nothing to be done for 'install-exec-am'.
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
ln -sf Trimmomatic-0.36 Trimmomatic
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
sh ./util/support_scripts/trinity_install_tests.sh
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Performing Unit Tests of Build

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Inchworm: has been Installed Properly
Chrysalis: has been Installed Properly
QuantifyGraph: has been Installed Properly
GraphFromFasta: has been Installed Properly
ReadsToTranscripts: has been Installed Properly
parafly: has been Installed Properly
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity

###############################################################################
#

______ ____ ____ ____ ____ ______ __ __
| || \ | || \ | || || | |
| || D ) | | | _ | | | | || | |
|_| |_|| / | | | | | | | |_| |_|| ~ |
| | | \ | | | | | | | | | |___, |
| | | . \ | | | | | | | | | | |
|__| |__|\_||____||__|__||____| |__| |____/

#
#
# Required:
#
# --seqType <string> :type of reads: ('fa' or 'fq')
#
# --max_memory :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)
# provided in Gb of RAM, ie. '--max_memory 10G'
#
# If paired reads:
# --left :left reads, one or more file names (separated by commas, no spaces)
# --right :right reads, one or more file names (separated by commas, no spaces)
#
# Or, if unpaired reads:
# --single :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )
#
# Or,
# --samples_file tab-delimited text file indicating biological replicate relationships.
# ex.
# cond_A cond_A_rep1 A_rep1_left.fq A_rep1_right.fq
# cond_A cond_A_rep2 A_rep2_left.fq A_rep2_right.fq
# cond_B cond_B_rep1 B_rep1_left.fq B_rep1_right.fq
# cond_B cond_B_rep2 B_rep2_left.fq B_rep2_right.fq
#
# # if single-end instead of paired-end, then leave the 4th column above empty.
#
####################################
## Misc: #########################
#
# --SS_lib_type :Strand-specific RNA-Seq read orientation.
# if paired: RF or FR,
# if single: F or R. (dUTP method = RF)
# See web documentation.
#
# --CPU :number of CPUs to use, default: 2
# --min_contig_length :minimum assembled contig length to report
# (def=200)
#
# --long_reads :fasta file containing error-corrected or circular consensus (CCS) pac bio reads
# (** note: experimental parameter **, this functionality continues to be under development)
#
# --genome_guided_bam :genome guided mode, provide path to coordinate-sorted bam file.
# (see genome-guided param section under --show_full_usage_info)
#
# --jaccard_clip :option, set if you have paired reads and
# you expect high gene density with UTR
# overlap (use FASTQ input file format
# for reads).
# (note: jaccard_clip is an expensive
# operation, so avoid using it unless
# necessary due to finding excessive fusion
# transcripts w/o it.)
#
# --trimmomatic :run Trimmomatic to quality trim reads
# see '--quality_trimming_params' under full usage info for tailored settings.
#
#
# --no_normalize_reads :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.
# see '--normalize_max_read_cov' under full usage info for tailored settings.
# (note, as of Sept 21, 2016, normalization is on by default)
#
# --no_distributed_trinity_exec :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.
#
#
# --output :name of directory for output (will be
# created if it doesn't already exist)
# default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir"
# note: must include 'trinity' in the name as a safety precaution! )
#
# --workdir :where Trinity phase-2 assembly computation takes place (defaults to --output setting).
# (can set this to a node-local drive or RAM disk)
#
# --full_cleanup :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta
#
# --cite :show the Trinity literature citation
#
# --verbose :provide additional job status info during the run.
#
# --version :reports Trinity version (Trinity-v2.6.6) and exits.
#
# --show_full_usage_info :show the many many more options available for running Trinity (expert usage).
#
#
###############################################################################
#
# *Note, a typical Trinity command might be:
#
# Trinity --seqType fq --max_memory 50G --left reads_1.fq --right reads_2.fq --CPU 6
#
#
# and for Genome-guided Trinity:
#
# Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G
# --genome_guided_max_intron 10000 --CPU 6
#
# see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/
# for sample data and 'runMe.sh' for example Trinity execution
#
# For more details, visit: http://trinityrnaseq.github.io
#
###############################################################################

Applications are invited from individuals who have high motivation to do research for the below mentioned position,

1. Research Associate - 1 No.
in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24.

Title of the Project: “Establishment of National Repository for Micro algae & Cyanobacteria” funded by Department of Biotechnology, Govt. of India

Qualification

1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA

Essential : Doctoral degree in relevant subject from recognized University/ Institutes
Desirable: Research experience in molecular biology and bioinformatics

Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.

Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf

The candidate is expected to have experience in handling functional genomics tools to dissect defense responses against bacterial pathogens and drought stress tolerance. This project may involve use of bioinformatics tools, database development, large scale transcriptome profiling, virus-induced gene silencing and any other research work as assigned by the PI.

Qualification: Candidates having a Ph. D. degree in Bioinformatics/Plant Molecular Biology/Plant Physiology/Plant Pathology/Plant Breeding & Genetics and strong publication record can apply. Candidates having prior work experience in using advanced molecular biology tools in laboratory with strong bioinformatics knowledge are preferred.

The Fellowship amount for the position will be given at par with the similar fellowships by DBT/DST.

NIPGR reserves the right to select the candidate against the above post depending upon the qualifications and experience of the candidate. Reservation of post shall be as per Govt. of India norms.

Eligible candidates may apply by sending hard copy of complete application in the given format with a cover letter showing interest and specifying the position. The attested copies of the mark-sheets, certificates, proof of research experience/publications are to be attached. The application should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by "Application for the post of RA under NIPGR Short-term research fellowship programme". No TA/DA will be paid for attending the interview.

ONLY hard copy of the application in the given format will be accepted.
www.nipgr.res.in/files/careers/format_RA2.doc

Dr. Senthil-Kumar Muthappa
Staff Scientist - III,
National Institute of Plant Genome Research (NIPGR)
Aruna Asaf Ali Marg, P.O. Box NO. 10531,
New Delhi - 110067

Assam Applications are invited for Walk-in-Interview for the following temporary positions in the MHRD sponsored Centre of Excellence under FAST project entitled “Machine Learning Research and Big Data Analysis” under the Principal Investigator Professor D.K. Bhattacharyya, Department of Computer Science & Engineering, Tezpur University.

Position : Senior Research Fellows (SRFs) in the field of (i) Bioinformatics (ii) Natural Language Processing / Speech Processing (iii) Cognitive Radio Networks / Optical Networks (iv) Network Security. No. of Positions : Five (05).

Qualification : First class in ME / M. Tech. in CSE / IT / ECE with research experience in relevant fields of research. Candidates having valid GATE / NET score shall be preferred.

Fellowship : Rs. 18,000/- (Rupees Eighteen Thousand) only per month.

Duration : Two (02) years and may be extended depending on status of the project.

Position : Junior Research Fellows (JRFs) in the field of Bioinformatics

No. of Positions : One (01).

Qualification : First class in B. Tech. in CSE / IT/ ECE or MCA with consistently good academic records. Candidates with M. Tech. in CSE / IT / ECE shall be preferred.

Fellowship : Rs. 12,000/- (Rupees twelve Thousand) only per month.

Duration : Two (02) years and may be extended depending on status of the project.

Interested candidates may send their application on plain paper by post along with his/her educational qualifications, research experience certificates (for Senior Research Fellow), 02 copies of recent passport/stamp size photograph and contact phone number to Prof. D.K. Bhattacharyya, Principal Investigator, Department of Computer Science & Engineering, Tezpur University, Napaam- 784028 or mail it to dkb@tezu.ernet.in (or to smh@tezu.ernet.in) within 15 days of publication of this advertisement.

Advertisement: www.tezu.ernet.in/ProjectWalkin/Advt_CoE_5816-A.pdf

Applications are invited for the post of Senior Research Fellow- SRF (one) and Junior Research Fellow- JRF (one) to be appointed in a SERB-funded major research project entitled “Biochemical and functional properties of Synechocystis Glutathione S-transferase(s)” sanctioned to Dr. Timir Tripathi, Molecular and Structural Biophysics Laboratory, Department of Biochemistry, NEHU, Shillong.

Essential Qualifications: For both positions M.Sc. or equivalent with a good academic record is a prerequisite.

For Project-SRF, experience in bioinformatics/computational biology is required, which should be evident by publications.

Students waiting for their last semester result can apply for JRF position.

Stipend: As per SERB norms.

Interested students can email their detailed bio-data including mobile number and recent photograph to msb.biochem@gmail.com, latest by 01.08.15. The hard copy is not required at this stage.

The date of interview will be informed after primary scrutiny of the applications. No TA/DA will be paid if called for interview. P.S: Students applied for the same post as per date 01.06.15, need not to apply again as their application will be considered in this advertisement also.

For details of the research work of the PI’s group kindly visit www.ttripathi.webs.com

Dr. Timir Tripathi Principal Investigator DST-SERB Project Department of Biochemistry NEHU, Shillong

Advertisement: www.nehu.ac.in/Advertisements/BiochemPVAdvtTT_200715.pdf

Eligibility : MSc(Bio-Chemistry, Bio-Informatics, Bio-Tech)

Location : Chennai

Last Date : 20 Aug 2015

Hiring Process : Walk - In
Alagappa University - Job Details

RA Bioinformatics Job position in Alagappa University

Qualification: M.Sc., in Bioinformatics/Biotechnology/Biophysics/Biochemistry/ Life Sciences

No.of Post: One

Salary : Rs. 11000
How to apply

A walk-in Interview will be held at the Department of Biotechnology, Alagappa University, Science Campus, Karaikudi 630 004 on 20.08.2015 (Thursday) at 10.30 AM.

Interested candidates are encouraged to send their Curriculum Vitae by email in advance. On the day of interview, the candidates must produce original certificates in proof of their educational qualification and experience and a recommendation letter from the Head of the Department/Institution where last studied/worked. Candidates who have already passed the required Degree alone are eligible to appear for interview.

Click Here for more http://alagappauniversity.ac.in/files/news_files/Notification.pdf