<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/19555?offset=440</link>
	<atom:link href="https://bioinformaticsonline.com/related/19555?offset=440" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22786/ra-at-university-of-delhi</guid>
  <pubDate>Wed, 17 Jun 2015 20:35:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at University of Delhi]]></title>
  <description><![CDATA[
<p>Research Scientist Jobs opportunity in University of Delhi on temporary basis</p>

<p>Qualifications : Ph. D.</p>

<p>Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics</p>

<p>No. of Post : 03</p>

<p>Department : Genetics</p>

<p>Salary : Rs. 60,000/-<br />How to apply</p>

<p>The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.</p>

<p>Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&amp;cntnt01articleid=5492&amp;cntnt01returnid=83</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</guid>
	<pubDate>Tue, 23 Jun 2015 10:39:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22906/at-what-age-did-you-gain-passion-in-bioinformatics</link>
	<title><![CDATA[At what age did you gain passion in Bioinformatics?]]></title>
	<description><![CDATA[<p>Most of the bioinformatician were biologist ( yeah ... not all ;), and at later stage they gain a passion in Bioinformatics and learn it. When did you get inclined towards computational analysis of biological data?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37225/installing-trinity</guid>
	<pubDate>Tue, 03 Jul 2018 04:31:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37225/installing-trinity</link>
	<title><![CDATA[Installing Trinity !]]></title>
	<description><![CDATA[
<p>Download this https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.6.6</p>

<p>➜ cd trinityrnaseq-Trinity-v2.6.6</p>

<p>➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make<br />Using gnu compiler for Inchworm and Chrysalis<br />cd Inchworm &amp;&amp; (test -e configure || autoreconf) \<br />                &amp;&amp; sh ./configure --prefix=`pwd`  &amp;&amp; make install<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking whether the C++ compiler works... yes<br />checking for C++ compiler default output file name... a.out<br />checking for suffix of executables... <br />checking whether we are cross compiling... no<br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />Making install in src<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp<br />mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp<br />mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp<br />mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp<br />mv -f .deps/IRKE.Tpo .deps/IRKE.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp<br />mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp<br />mv -f .deps/string_util.Tpo .deps/string_util.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp<br />mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp<br />mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp<br />mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp<br />mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp<br />mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp<br />mv -f .deps/Cigar.Tpo .deps/Cigar.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp<br />mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp<br />FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector &gt;, int, bool, ArgProcessor)’:<br />FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                 if (seq_region.size() &lt; kmer_length) { continue; }  // can be e<br />                                       ^<br />mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp<br />mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp<br />fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&amp;, std::__cxx11::string&amp;)’:<br />fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]<br />     unsigned int kmer_length = kcounter.get_kmer_length();<br />                  ^<br />mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o  <br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"<br />  /usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Nothing to be done for 'install-exec-am'.<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />cd Chrysalis &amp;&amp; make UNSUPPORTED=yes <br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator&lt;(const makefile_builder::dependency&amp;) const’:<br />./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                dependent_ == other.dependent_ &amp;&amp;<br />                                               ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator&lt;(const makefile_builder::subdir_and_target&amp;) const’:<br />./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                subdir_ == other.subdir_ &amp;&amp;<br />                                         ^<br />./MakeDepend.cc: In function ‘int main(int, char**)’:<br />./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]<br />   char * options = "Ad:g:u:fh";<br />                    ^<br />./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&amp;)’:<br />./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />       if ( ! this-&gt;FileIsSource( dependent ) &amp;&amp; ! this-&gt;FileIsHeader( dependent<br />                                              ^<br />./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />            this-&gt;FileIsHeader( dependent ) &amp;&amp; this-&gt;FileIsSource( provider ) ) <br />                                            ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&amp;) const’:<br />./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />   return ( filename.size() &gt; 2 &amp;&amp;<br />                                ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:04 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:06 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o<br />./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i &gt; DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:<br />./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; left_extensions.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int j = 0; j &lt; right_extensions.size(); j++) {<br />                           ^<br />./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&amp;, std::vector &gt;&amp;, char, std::map&amp;, int)’:<br />./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; adjacent_kmers.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         if (kmer_extension_chars.size() == flank_extension_length) {<br />                                         ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:30 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o<br />./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  if (_base_to_int[c] &gt; 3)<br />                    ^<br />./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  int val = _base_to_int[c];<br />                          ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:31 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o<br />/bin/rm -f lib_BubbleUpClustering_temp.a<br />ar -qc  lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./BubbleUpClustering<br />g++ -ggdb3    -fopenmp  -o ./BubbleUpClustering  obj/analysis/BubbleUpClustering.o -L. -lm -pthread     -l_BubbleUpClustering_temp<br />/bin/rm lib_BubbleUpClustering_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:32 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o<br />./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:<br />./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />     system(command.c_str());<br />                            ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:35 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o<br />./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&amp;, FILE*, int, bool)’:<br />./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i&lt;=d.isize()-k; i++) {<br />                    ^<br />/bin/rm -f lib_Chrysalis_temp.a<br />ar -qc  lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./Chrysalis<br />g++ -ggdb3    -fopenmp  -o ./Chrysalis  obj/analysis/Chrysalis.o -L. -lm -pthread     -l_Chrysalis_temp<br />/bin/rm lib_Chrysalis_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:39 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o<br />/bin/rm -f lib_CreateIwormFastaBundle_temp.a<br />ar -qc  lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./CreateIwormFastaBundle<br />g++ -ggdb3    -fopenmp  -o ./CreateIwormFastaBundle  obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread     -l_CreateIwormFastaBundle_temp<br />/bin/rm lib_CreateIwormFastaBundle_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:42 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o<br />./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&amp;)’:<br />./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />               &amp;&amp; <br />               ^<br />./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map&lt;int, Pool&gt;&amp;, std::map&amp;)’:<br />./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (int j = 0; j &lt; adjacent_nodes.size(); j++) {<br />                               ^<br />./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:<br />./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i bubble_up_cluster_growth(std::map&amp;, std::map&amp;)’:<br />./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                           ^<br />./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&amp;, vecDNAVector&amp;)’:<br />./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t i = 0; i &lt; p.size(); i++) {<br />                              ^<br />./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:<br />./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {<br />                                                            ^<br />./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (i=0; i&lt;clustered_pools.isize(); i++) {<br />                ^<br />./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />/bin/rm -f lib_GraphFromFasta_MPI_temp.a<br />ar -qc  lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./GraphFromFasta_MPI<br />g++ -ggdb3    -fopenmp  -o ./GraphFromFasta_MPI  obj/GraphFromFasta_MPI.o -L. -lm -pthread     -l_GraphFromFasta_MPI_temp<br />/bin/rm lib_GraphFromFasta_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:53 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o<br />./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:<br />./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matchesLeft.isize(); j++) {<br />                ^<br />./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matches.isize(); j++) {<br />                ^<br />/bin/rm -f lib_IsoformAugment_temp.a<br />ar -qc  lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./IsoformAugment<br />g++ -ggdb3    -fopenmp  -o ./IsoformAugment  obj/analysis/IsoformAugment.o -L. -lm -pthread     -l_IsoformAugment_temp<br />/bin/rm lib_IsoformAugment_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:56 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o<br />./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />/bin/rm -f lib_JoinTransByPairs_temp.a<br />ar -qc  lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./JoinTransByPairs<br />g++ -ggdb3    -fopenmp  -o ./JoinTransByPairs  obj/analysis/JoinTransByPairs.o -L. -lm -pthread     -l_JoinTransByPairs_temp<br />/bin/rm lib_JoinTransByPairs_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:00 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o<br />/bin/rm -f lib_QuantifyGraph_temp.a<br />ar -qc  lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./QuantifyGraph<br />g++ -ggdb3    -fopenmp  -o ./QuantifyGraph  obj/analysis/QuantifyGraph.o -L. -lm -pthread     -l_QuantifyGraph_temp<br />/bin/rm lib_QuantifyGraph_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:03 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o<br />/bin/rm -f lib_ReadsToTranscripts_temp.a<br />ar -qc  lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts  obj/analysis/ReadsToTranscripts.o -L. -lm -pthread     -l_ReadsToTranscripts_temp<br />/bin/rm lib_ReadsToTranscripts_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI  obj/ReadsToTranscripts_MPI.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:14 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI_chang<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI_chang  obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_chang_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:18 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:<br />./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />       system(rm.c_str());<br />                         ^<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:<br />./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());<br />                           ^<br />./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());   <br />                           ^<br />/bin/rm -f lib_RunButterfly_temp.a<br />ar -qc  lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./RunButterfly<br />g++ -ggdb3    -fopenmp  -o ./RunButterfly  obj/analysis/RunButterfly.o -L. -lm -pthread     -l_RunButterfly_temp<br />/bin/rm lib_RunButterfly_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:23 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o<br />./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:<br />./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;=d.lsize()-k; j++) {<br />                ^<br />./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />       for (int x=j; x&lt;j+k; x++) {<br />                      ^<br />/bin/rm -f lib_TranscriptomeFromVaryK_temp.a<br />ar -qc  lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./TranscriptomeFromVaryK<br />g++ -ggdb3    -fopenmp  -o ./TranscriptomeFromVaryK  obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread     -l_TranscriptomeFromVaryK_temp<br />/bin/rm lib_TranscriptomeFromVaryK_temp.a<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />cd trinity-plugins &amp;&amp; make trinity_essentials<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />tar xvf seqtk-trinity.v0.0.2.tar.gz<br />seqtk-trinity-0.0.2/<br />seqtk-trinity-0.0.2/.gitignore<br />seqtk-trinity-0.0.2/LICENSE<br />seqtk-trinity-0.0.2/Makefile<br />seqtk-trinity-0.0.2/README.md<br />seqtk-trinity-0.0.2/khash.h<br />seqtk-trinity-0.0.2/kseq.h<br />seqtk-trinity-0.0.2/seqtk.c<br />seqtk-trinity-0.0.2/testing/<br />seqtk-trinity-0.0.2/testing/newformat_1.fq<br />seqtk-trinity-0.0.2/testing/newformat_2.fq<br />seqtk-trinity-0.0.2/testing/oldformat_1.fq<br />seqtk-trinity-0.0.2/testing/oldformat_2.fq<br />cd seqtk-trinity-0.0.2 &amp;&amp; make<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm<br />seqtk.c: In function ‘stk_comp’:<br />seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]<br />    int la, lb, lc, na, nb, nc, cnt[11];<br />                ^<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.<br />tar -zxvf "ParaFly-0.1.0".tar.gz &amp;&amp; \<br />cd "ParaFly-0.1.0" &amp;&amp; sh ./configure --prefix=`pwd` &amp;&amp; make install &amp;&amp; \<br />cp bin/ParaFly ../BIN/<br />ParaFly-0.1.0/<br />ParaFly-0.1.0/LICENSE<br />ParaFly-0.1.0/Makefile<br />ParaFly-0.1.0/Makefile.am<br />ParaFly-0.1.0/Makefile.in<br />ParaFly-0.1.0/README.md<br />ParaFly-0.1.0/aclocal.m4<br />ParaFly-0.1.0/bin/<br />ParaFly-0.1.0/bin/ParaFly<br />ParaFly-0.1.0/config.h<br />ParaFly-0.1.0/config.h.in<br />ParaFly-0.1.0/config.log<br />ParaFly-0.1.0/config.status<br />ParaFly-0.1.0/configure<br />ParaFly-0.1.0/configure.ac<br />ParaFly-0.1.0/depcomp<br />ParaFly-0.1.0/install-sh<br />ParaFly-0.1.0/missing<br />ParaFly-0.1.0/src/<br />ParaFly-0.1.0/src/.deps/<br />ParaFly-0.1.0/src/.deps/ParaFly.Po<br />ParaFly-0.1.0/src/.deps/argProcessor.Po<br />ParaFly-0.1.0/src/Makefile<br />ParaFly-0.1.0/src/Makefile.am<br />ParaFly-0.1.0/src/Makefile.in<br />ParaFly-0.1.0/src/ParaFly.cpp<br />ParaFly-0.1.0/src/argProcessor.cpp<br />ParaFly-0.1.0/src/argProcessor.hpp<br />ParaFly-0.1.0/stamp-h1<br />ParaFly-0.1.0/test/<br />ParaFly-0.1.0/test/Makefile<br />ParaFly-0.1.0/test/cmds.txt<br />ParaFly-0.1.0/test/rand_exit.pl<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking for C++ compiler default output file name... a.out<br />checking whether the C++ compiler works... yes<br />checking whether we are cross compiling... no<br />checking for suffix of executables... <br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />Making install in src<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp<br />mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2   -o ParaFly ParaFly.o argProcessor.o  <br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"<br />  /usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Nothing to be done for 'install-exec-am'.<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />ln -sf Trimmomatic-0.36 Trimmomatic<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />sh ./util/support_scripts/trinity_install_tests.sh<br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~</p>

<p>Performing Unit Tests of Build<br /> <br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~<br />Inchworm:                has been Installed Properly<br />Chrysalis:               has been Installed Properly<br />QuantifyGraph:           has been Installed Properly<br />GraphFromFasta:          has been Installed Properly<br />ReadsToTranscripts:      has been Installed Properly<br />parafly:                 has been Installed Properly<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity</p>

<p>###############################################################################<br />#</p>

<p>     ______  ____   ____  ____   ____  ______  __ __<br />    |      ||    \ |    ||    \ |    ||      ||  |  |<br />    |      ||  D  ) |  | |  _  | |  | |      ||  |  |<br />    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |<br />      |  |  |    \  |  | |  |  | |  |   |  |  |___, |<br />      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |<br />      |__|  |__|\_||____||__|__||____|  |__|  |____/</p>

<p>#<br />#<br /># Required:<br />#<br />#  --seqType &lt;string&gt;      :type of reads: ('fa' or 'fq')<br />#<br />#  --max_memory       :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)<br />#                            provided in Gb of RAM, ie.  '--max_memory 10G'<br />#<br />#  If paired reads:<br />#      --left      :left reads, one or more file names (separated by commas, no spaces)<br />#      --right     :right reads, one or more file names (separated by commas, no spaces)<br />#<br />#  Or, if unpaired reads:<br />#      --single    :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )<br />#<br />#  Or,<br />#      --samples_file          tab-delimited text file indicating biological replicate relationships.<br />#                                   ex.<br />#                                        cond_A    cond_A_rep1    A_rep1_left.fq    A_rep1_right.fq<br />#                                        cond_A    cond_A_rep2    A_rep2_left.fq    A_rep2_right.fq<br />#                                        cond_B    cond_B_rep1    B_rep1_left.fq    B_rep1_right.fq<br />#                                        cond_B    cond_B_rep2    B_rep2_left.fq    B_rep2_right.fq<br />#<br />#                      # if single-end instead of paired-end, then leave the 4th column above empty.<br />#<br />####################################<br />##  Misc:  #########################<br />#<br />#  --SS_lib_type           :Strand-specific RNA-Seq read orientation.<br />#                                   if paired: RF or FR,<br />#                                   if single: F or R.   (dUTP method = RF)<br />#                                   See web documentation.<br />#<br />#  --CPU                      :number of CPUs to use, default: 2<br />#  --min_contig_length        :minimum assembled contig length to report<br />#                                   (def=200)<br />#<br />#  --long_reads            :fasta file containing error-corrected or circular consensus (CCS) pac bio reads<br />#                                   (** note: experimental parameter **, this functionality continues to be under development)<br />#<br />#  --genome_guided_bam     :genome guided mode, provide path to coordinate-sorted bam file.<br />#                                   (see genome-guided param section under --show_full_usage_info)<br />#<br />#  --jaccard_clip                  :option, set if you have paired reads and<br />#                                   you expect high gene density with UTR<br />#                                   overlap (use FASTQ input file format<br />#                                   for reads).<br />#                                   (note: jaccard_clip is an expensive<br />#                                   operation, so avoid using it unless<br />#                                   necessary due to finding excessive fusion<br />#                                   transcripts w/o it.)<br />#<br />#  --trimmomatic                   :run Trimmomatic to quality trim reads<br />#                                        see '--quality_trimming_params' under full usage info for tailored settings.<br />#                                  <br />#<br />#  --no_normalize_reads            :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.<br />#                                       see '--normalize_max_read_cov' under full usage info for tailored settings.<br />#                                       (note, as of Sept 21, 2016, normalization is on by default)<br />#     <br />#  --no_distributed_trinity_exec   :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.<br />#<br />#<br />#  --output                :name of directory for output (will be<br />#                                   created if it doesn't already exist)<br />#                                   default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir" <br />#                                    note: must include 'trinity' in the name as a safety precaution! )<br />#             <br />#  --workdir               :where Trinity phase-2 assembly computation takes place (defaults to --output setting).<br />#                                  (can set this to a node-local drive or RAM disk)     <br />#  <br />#  --full_cleanup                  :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta<br />#<br />#  --cite                          :show the Trinity literature citation<br />#<br />#  --verbose                       :provide additional job status info during the run.<br />#<br />#  --version                       :reports Trinity version (Trinity-v2.6.6) and exits.<br />#<br />#  --show_full_usage_info          :show the many many more options available for running Trinity (expert usage).<br />#<br />#<br />###############################################################################<br />#<br />#  *Note, a typical Trinity command might be:<br />#<br />#        Trinity --seqType fq --max_memory 50G --left reads_1.fq  --right reads_2.fq --CPU 6<br />#<br />#<br />#    and for Genome-guided Trinity:<br />#<br />#        Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G<br />#                --genome_guided_max_intron 10000 --CPU 6<br />#<br />#     see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/<br />#          for sample data and 'runMe.sh' for example Trinity execution<br />#<br />#     For more details, visit: http://trinityrnaseq.github.io<br />#<br />###############################################################################</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22965/ra-bioinformatics-at-bharathidasan-university</guid>
  <pubDate>Sun, 28 Jun 2015 12:21:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Bharathidasan University]]></title>
  <description><![CDATA[
<p>National Facility for Marine Cyanobacteria <br />Department of Marine Biotechnology <br />Bharathidasan University <br />Tiruchirappalli -620024, Tamil Nadu </p>

<p>Applications are invited from individuals who have high motivation to do research for the below mentioned position, </p>

<p>1. Research Associate - 1 No. <br />in the DBT sponsored project under the supervision of Dr. D. Prabaharan, Principal Investigator, National Facility for Marine Cyanobacteria, Dept. of Marine Biotechnology, Bharathidasan University, Tiruchirappalli-24. </p>

<p>Title of the Project: “Establishment of National Repository for Micro algae &amp; Cyanobacteria” funded by Department of Biotechnology, Govt. of India </p>

<p>Qualification </p>

<p>1. Research Associate – 1 No. Rs. 36,000/38,000/40,000 per month for I, II and III year + 20% HRA </p>

<p>Essential : Doctoral degree in relevant subject from recognized University/ Institutes <br />Desirable: Research experience in molecular biology and bioinformatics </p>

<p>Interested candidates can send their complete CV in plain paper with a passport size photograph, with details of Marks secured in all subjects from plus two stage (with proof, full postal address, sex, date of birth, community etc., along with additional qualification or experiences and two address of references whom could be contacted (One of whom should be PG teacher/guide). Application should reach the Principal Investigator on or before 30.06.2015 by Email (nfmcbic@yahoo.com)/Registered post/ Speed post, with subject subscribed as “Application for Research Associate /Technical Assistant /Lab attendant”. Qualifying candidates will be short listed and communicated with date of interview. No TA and DA will be given for attending the interview. Addressfor Communication Dr. D. Prabaharan Principal Investigator National Facility for Marine Cyanobacteria Bharathidasan University Tiruchirappalli-620024, Tamil Nadu.</p>

<p>Advertisement: http://www.bdu.ac.in/adv/NFMC_Project_Positions.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23627/ra-bioinformatics-at-nipgr</guid>
  <pubDate>Tue, 04 Aug 2015 18:53:29 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at NIPGR]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for filling up one position of Research Associate (RA) in the Institute with Dr. Senthil-Kumar Muthappa, Scientist, NIPGR, in the scheme of "Short-Term Research Fellowship" programme. The position is completely on temporary basis with maximum duration of three years. The initial appointment will be for a period of one year, which can be curtailed or extended based on the performance of the candidate and discretion of the Competent Authority.</p>

<p>The candidate is expected to have experience in handling functional genomics tools to dissect defense responses against bacterial pathogens and drought stress tolerance. This project may involve use of bioinformatics tools, database development, large scale transcriptome profiling, virus-induced gene silencing and any other research work as assigned by the PI.</p>

<p>Qualification: Candidates having a Ph. D. degree in Bioinformatics/Plant Molecular Biology/Plant Physiology/Plant Pathology/Plant Breeding &amp; Genetics and strong publication record can apply. Candidates having prior work experience in using advanced molecular biology tools in laboratory with strong bioinformatics knowledge are preferred.</p>

<p>The Fellowship amount for the position will be given at par with the similar fellowships by DBT/DST.</p>

<p>NIPGR reserves the right to select the candidate against the above post depending upon the qualifications and experience of the candidate. Reservation of post shall be as per Govt. of India norms.</p>

<p>Eligible candidates may apply by sending hard copy of complete application in the given format with a cover letter showing interest and specifying the position. The attested copies of the mark-sheets, certificates, proof of research experience/publications are to be attached. The application should reach at the address given below within 15 days from the date of advertisement. The envelope must be superscribed by "Application for the post of RA under NIPGR Short-term research fellowship programme". No TA/DA will be paid for attending the interview.</p>

<p>ONLY hard copy of the application in the given format will be accepted.<br />www.nipgr.res.in/files/careers/format_RA2.doc</p>

<p>Dr. Senthil-Kumar Muthappa<br />Staff Scientist - III,<br />National Institute of Plant Genome Research (NIPGR)<br />Aruna Asaf Ali Marg, P.O. Box NO. 10531,<br />New Delhi - 110067</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23379/jrf-in-bioinformatics-tezpur-universityn</guid>
  <pubDate>Fri, 17 Jul 2015 19:42:22 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF in Bioinformatics @ Tezpur Universityn]]></title>
  <description><![CDATA[
<p>Tezpur University: Napaam – 784 028:</p>

<p>Assam Applications are invited for Walk-in-Interview for the following temporary positions in the MHRD sponsored Centre of Excellence under FAST project entitled “Machine Learning Research and Big Data Analysis” under the Principal Investigator Professor D.K. Bhattacharyya, Department of Computer Science &amp; Engineering, Tezpur University.</p>

<p>Position : Senior Research Fellows (SRFs) in the field of (i) Bioinformatics (ii) Natural Language Processing / Speech Processing (iii) Cognitive Radio Networks / Optical Networks (iv) Network Security. No. of Positions : Five (05).</p>

<p>Qualification : First class in ME / M. Tech. in CSE / IT / ECE with research experience in relevant fields of research. Candidates having valid GATE / NET score shall be preferred.</p>

<p>Fellowship : Rs. 18,000/- (Rupees Eighteen Thousand) only per month.</p>

<p>Duration : Two (02) years and may be extended depending on status of the project.</p>

<p>Position : Junior Research Fellows (JRFs) in the field of Bioinformatics</p>

<p>No. of Positions : One (01).</p>

<p>Qualification : First class in B. Tech. in CSE / IT/ ECE or MCA with consistently good academic records. Candidates with M. Tech. in CSE / IT / ECE shall be preferred.</p>

<p>Fellowship : Rs. 12,000/- (Rupees twelve Thousand) only per month.</p>

<p>Duration : Two (02) years and may be extended depending on status of the project.</p>

<p>Interested candidates may send their application on plain paper by post along with his/her educational qualifications, research experience certificates (for Senior Research Fellow), 02 copies of recent passport/stamp size photograph and contact phone number to Prof. D.K. Bhattacharyya, Principal Investigator, Department of Computer Science &amp; Engineering, Tezpur University, Napaam- 784028 or mail it to dkb@tezu.ernet.in (or to smh@tezu.ernet.in) within 15 days of publication of this advertisement.</p>

<p>Advertisement: www.tezu.ernet.in/ProjectWalkin/Advt_CoE_5816-A.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23493/srf-post-in-nehu-shillong</guid>
  <pubDate>Sat, 25 Jul 2015 20:09:50 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF post in NEHU, Shillong]]></title>
  <description><![CDATA[
<p>Dept of Biochemistry<br />North-Eastern Hill University<br />Umshing, Shillong- 793 022</p>

<p>Applications are invited for the post of Senior Research Fellow- SRF (one) and Junior Research Fellow- JRF (one) to be appointed in a SERB-funded major research project entitled “Biochemical and functional properties of Synechocystis Glutathione S-transferase(s)” sanctioned to Dr. Timir Tripathi, Molecular and Structural Biophysics Laboratory, Department of Biochemistry, NEHU, Shillong.</p>

<p>Essential Qualifications: For both positions M.Sc. or equivalent with a good academic record is a prerequisite.</p>

<p>For Project-SRF, experience in bioinformatics/computational biology is required, which should be evident by publications.</p>

<p>Students waiting for their last semester result can apply for JRF position.</p>

<p>Stipend: As per SERB norms.</p>

<p>Interested students can email their detailed bio-data including mobile number and recent photograph to msb.biochem@gmail.com, latest by 01.08.15. The hard copy is not required at this stage.</p>

<p>The date of interview will be informed after primary scrutiny of the applications. No TA/DA will be paid if called for interview. P.S: Students applied for the same post as per date 01.06.15, need not to apply again as their application will be considered in this advertisement also.</p>

<p>For details of the research work of the PI’s group kindly visit www.ttripathi.webs.com</p>

<p>Dr. Timir Tripathi Principal Investigator DST-SERB Project Department of Biochemistry NEHU, Shillong</p>

<p>Advertisement: www.nehu.ac.in/Advertisements/BiochemPVAdvtTT_200715.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23673/ra-bioinformatics-at-alagappa-university</guid>
  <pubDate>Sat, 08 Aug 2015 01:36:35 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at Alagappa University]]></title>
  <description><![CDATA[
<p>RA Bioinformatics</p>

<p>Eligibility : MSc(Bio-Chemistry, Bio-Informatics, Bio-Tech)</p>

<p>Location : Chennai</p>

<p>Last Date : 20 Aug 2015</p>

<p>Hiring Process : Walk - In<br />Alagappa University - Job Details</p>

<p>RA Bioinformatics Job position in Alagappa University</p>

<p>Qualification: M.Sc., in Bioinformatics/Biotechnology/Biophysics/Biochemistry/ Life Sciences</p>

<p>No.of Post: One</p>

<p>Salary : Rs. 11000<br />How to apply</p>

<p>A walk-in Interview will be held at the Department of Biotechnology, Alagappa University, Science Campus, Karaikudi 630 004 on 20.08.2015 (Thursday) at 10.30 AM.</p>

<p>Interested candidates are encouraged to send their Curriculum Vitae by email in advance. On the day of interview, the candidates must produce original certificates in proof of their educational qualification and experience and a recommendation letter from the Head of the Department/Institution where last studied/worked. Candidates who have already passed the required Degree alone are eligible to appear for interview.</p>

<p>Click Here for more http://alagappauniversity.ac.in/files/news_files/Notification.pdf</p>
]]></description>
</item>

</channel>
</rss>