Walk- in- Test cum Interview (based on test) for the selection of Research Associate

under the scheme “Distributed Information Sub Centre –DISC” & Research Assistant under scheme “Phytophthora, Fusarium and Ralstonia diseases of Horticultural and Field Crops” will be held at this Institute as per details indicated below.

WALK -IN- TEST CUM INTERVIEW

Name of the post : Research Associate

Date of Interview : 21-05-2014 at 10.00 AM

No. of posts : One

Qualifications : a)Essential

Ph.D Degree in Bioinformatics OR : Masters degree in Bioinformatics with a minimum of
60% marks or equivalent OGPA with at least two years research experience as evidenced from fellowship/ associateship/training/published papers etc.

b)Desirable: Experience in NGS data analysis.

Emoluments : Rs. 23,000/- per month + HRA (Masters Degree Holders)

Rs. 24,000/- per month + HRA (Ph.D Degree Holders)

Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)

Duration of Project : Till 31-03-2017.

Title of Assigment : Research Assistant (on contract basis)

No. of vacancy : One

Qualification : Essential : Post Graduation in Bioinformatics and Minimum one year experience in NGS data analysis

Desirable : Experience in Perl/Python/R

Remuneration : Rs. 20,000/- per month (consolidated)

Scope of work :

1. Analysis of different file formats and their conversions.

2. Assessing the quality of data and filtering of raw reads.
3. Assembling the raw reads-de novo as well as reference mapping.
4. Compression of aligned reads using Jam tools
5. RNA-seq. Analysis
6. Differential expression testing involving Normalization, Statistical testing, heat map generation & hierarchical clustering
7. Annotating the assembled genome and geneet testing and their validation
8. Metabolic pathway analysis
9. Comparative genomics
10. Setting up of genome browsers.

Period of Assigment : Initially for six months.

Date & Venue of Interview : 21-05-2014 at IISR, Kozhikode at 10.00 AM

More at http://www.spices.res.in/pdf/disc-advtmnt.pdf

More http://www.nieduszynski.org/index.php
http://www.path.ox.ac.uk/research/cell-biology-and-pathology/conrad-nieduszynski-group

Experience Required: 3-5 years of experience

No of Positions : Multiple

Qualifications: Candidates with minimum qualification as M.Sc Bioinformatics with 3-5 years of experience in Life sciences R&D or Pharma Industry.

Ph.D candidates with research experience in Bioinformatics with publications in International journal and minimum 2 years of industry experience in clinical genomics will be preferred for this position.

Requirement:

1. Must have basic understanding of molecular biology and Genomics.

2. Experience in application development or must have expertise in programming using either of Perl/Python.

3. Experience in statistical programming using R/Bioconductor/Matlab.

4. Strong concept in statistical and mathematical modelling.

5. Experience in designing and developing the bioinformatics pipeline.

6. Must have minimum 2+ years of hands on experience in NSG data analysis such as RNA-Seq,Exome-Seq ,Chip-Seq and downstream analysis.

7. Knowledge in WGS ,WES, Targeted re-sequencing,GWAS and population genomics will be preferred.

8. Must have experience working on opensource software/Framework and commercial software for NGS data analysis and reporting.

9. Should be aware of handling big data and guiding team members on multiple projects simultaneously.

10. Should have experience coordinating with different groups of clinical research scientist for various project requirements.

11. Ability to work as team as well as independently with minimal support.

More at http://www.ocimumbio.com/careers1/

Address of the bookmark: https://cloud.google.com/genomics/

Handle sequence locations for bioinformatics http://www.ingolia-lab.org/seqloc-tutorial.html

Address of the bookmark: http://www.stackage.org/snapshot/nightly-2014-12-28/package/seqloc-0.6

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}