Mojolicious aims to provide a complete web development experience. It thus has no hard dependencies, comes with a built-in development and production server and many other features one needs to build a web application. It's easy to install, has an applciation generator script and many plugins and extensions.

Libraries for developing Web applications

• Amon2
• Catalyst - Overflowing with features. Very popular.
• Dancer (Official site)
• Dancer2
• Gantry - Web application framework for mod_perl, cgi, etc.
• Kossy - A Web framework with simple interface.
• Mojolicious - An all in one framework.
• Poet - a modern Perl web framework for Mason developers

Address of the bookmark: https://www.ynonperek.com/2017/09/28/perl-mojolicious-web-development/

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Special Symbols – File handlers

$@ Perl error string

$! Error number from C, ‘errno’

$^E Extended OS error info, such as ‘CDROM tray not closed’

$? Exit status from last process

$AGRV – name of current file

@ARGV – command line arguments

$ARGV – special file handle for command line filenames

$. – current line number

$/ - input line delimiter

$\ - output line delimiter

$% - current page number

$&/${^MATCH} – last successful matching string

$`/${^PREMATCH} – the string preceding the last matching string

$’/${^POSTMATCH} – the string following the last matching string

$1, $2, … - matching groups in the parentheses in pattern

More at https://www.tutorialspoint.com/perl/perl_special_variables.htm

Most people who have a balanced translocation have the right amount of chromosome material but it has been rearranged in some way. This may happen if two chromosomes swap pieces (a reciprocal translocation). In other cases two whole chromosomes may become stuck together (a Robertsonian translocation). This page describes what happens when someone has a reciprocal translocation.

Reciprocal chromosomal translocations occur following double-strand breaks (DSBs) in DNA when a section of one chromosome is exchanged with that of another, non-homologous chromosome. These exchanges may produce a dysfunctional fusion gene that disrupts cell growth and survival pathways, such as the translocations seen in leukemia and childhood sarcomas.

Chromosomal translocations have been well studied in cancer cell lines which are associated with two types of cancer, acute myeloid leukemia and Ewing's sarcoma, but determining how they contribute to cancer development is complicated by additional mutations and altered gene expression profiles in these cultured cells. Now, Juan Carlos Ramirez, head of the Viral Vector Facility at the Fundacion Centro Nacional de Investigaciones Cardiovasculares (CNIC) and his colleagues Raul Torres at CNIC and Sandra Rodriguez-Peralez at the Spanish National Cancer Center (CNIO) in Madrid, Spain have used a new genome editing tool, CRISPR-Cas9, to induce chromosomal translocations for the first time in a human cell line and in primary cells. The study's authors conclude by stating that the use of this technology will allow for the clarification of how and why chromosomal translocation occurs, which without doubt will allow new anti-cancer therapeutic strategies to be tackled.

Using RNA-Guided Endonuclease (RGEN) technology or CRISPR/Cas9 genome engineering technology, CNIO and CNIC researchers have shown that it is possible to obtain such chromosomal translocations. The CRISPR-Cas9 system is extremely simple to introduce a cut at the desired locus, easier to design, and cheaper than many other systems. Using the CRISPR-Cas9 system, Ramirez and his colleagues reproduced the translocations observed in Ewing’s Sarcoma (ES) and Acute Myeloid Leukemia (AML) patient cell lines in HEK293 cells and also generated the ES translocation in human mesenchymal stem cells and the AML translocation in umbilical cord blood cells.

By focusing on chromosomal translocation without the confounding characteristics of established cell lines, these new cells lines should help answer the fundamental question of what causes a cell to become cancerous. Ramirez and his team now look forward to modeling other chromosome translocations in a variety of cell types.

Reference:

http://en.wikipedia.org/wiki/Chromosomal_translocation

http://www.nature.com/ncomms/2014/140603/ncomms4964/abs/ncomms4964.html

Alternatively, use one liner perl script:

perl -ne 'if(/^>(\S+)/){$c=$i{$1}}$c?print:chomp;$i{$_}=1 if @ARGV' GIs.txt >sequence.fasta

where GIs.txt contains a list of GIs or accession IDs.

(from :http://edwards.sdsu.edu/labsite/index.php/robert?start=5)

Address of the bookmark: http://edwards.sdsu.edu/labsite/index.php/robert/380-ncbi-sequence-or-fasta-batch-download-using-entrez

To resolve this, download and have in SSPACED-Longreads folder.

Cheers :)

a) M.Sc/or equivalent in biological sciences/related areas [Position Code: PA_JRF_PF_a]
b) B.E/B.Tech/ M.Sc in biotechnology/bioinformatics/computer science/Chemistry/Physics or MCA [Position Code: PA_JRF_PF_b]
c) M.Sc/or equivalent in wildlife sciences/ecology/environmental sciences or MBBS/BVSc/MVSc. [Position Code: PA_JRF_PF_c]

(Candidates with result awaited are NOT eligible to apply)

Upper Age limit 28years

Rs.12000 / Rs.16000 (as sanctioned by the funding agency)

2. Post Doctoral Fellow/Research Associate in multiple research areas [PDF_RA]

Ph.D. (submitted/awarded) in any branch of biological Sciences. Candidates with Ph.D. in other sciences are also encouraged to apply.

Experience in molecular biology, biochemistry, structural biology, cell biology, infectious disease, conservation genetics, veterinary science, reproductive biology, and molecular diagnostics is desired but not mandatory.

[Position Code: PDF_RA]

UpperAge limit 35years

Rs. 22000- 26000 (as sanctioned by the funding agency)

3. Post Doctoral Scientist Fellow [PDSF]

Ph.D in any of the following areas: bioinformatics, next generation sequencing, high throughput data analysis, proteomics, bio-statistics, computer science, information technology, computer hardware and networking/clustering, parallel processing.
[Position Code: PDSF]

Upper Age limit 40 years

Rs. 40000 consolidated (as sanctioned by the funding agency)

Download Application: Last date for apply online: 09th Oct 2014

Advertisement: www.ccmb.res.in//index.php?view=notifications&mid=0&id=71&nid=38

Apply online http://www.ccmb.res.in/positions/temp_notif/online_form.html

More at http://www.ccmb.res.in//index.php?view=notifications&mid=0&id=71&nid=38

ArrayGen specializes in Genomics data analysis and research, as we believe in the level of precision, predictability, benchmark-ability, and data analysis capability of genomics data over other forms of biological data. ArrayGen constantly strives to develop new solutions, and plug the existing gaps in the technological advancement of the field.

More http://www.arraygen.com/