The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.

https://code.google.com/p/biowiki/

https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk

NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&projectsearch=Search+projects

NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&projectsearch=Search+projects

Address of the bookmark: https://code.google.com/hosting/search?q=bioinformatics&sa=Search

More at http://bcil.nic.in/default.htm

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

With InsideDNA, you can upload and store your own genomic/genetic datasets in a limitless cloud space, and instantly analyze it with a powerful compute instance, without any tool installation or set up hassle.

More at https://insidedna.me/

Address of the bookmark: https://insidedna.me/

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

#Find the reverse complement of a DNA string.
#Given: A DNA string Pattern.
#Return: Pattern, the reverse complement of Pattern.

use strict;
use warnings;

my $string="AAAACCCGGT";
my $finalString="";
my %hash = (
    "C" => "G",
    "A" => "T",
    "T" => "A",
    "G" => "C",
);

for (my $aa=0; $aa<=(length($string)-1); $aa++) {
    my $char=substr $string, $aa, 1;
    #print $hash{$char};
    $finalString="$hash{$char}"."$finalString";
}

print $finalString;
print "\n";