BOL: Related items

Encode sequencing data freely available to download and use for academic means

Rahul Agarwal — Thu, 13 Mar 2014 18:18:08 -0500

In Encode, regulatory elements investigated via DNA hypersensitivity assays, assays of DNA methylation, and chromatin immunoprecipitation (ChIP) of proteins that interact with DNA, including modified histones and transcription factors, followed by sequencing (ChIP-Seq).

More information:

https://genome.ucsc.edu/ENCODE/pilot.html

Address of the bookmark: https://genome.ucsc.edu/ENCODE/

Strand Life Sciences announces the release of Strand NGS v3.1 at ASHG 2017

Yeshodari — Mon, 23 Oct 2017 02:36:05 -0500

Strand Life Sciences announces the release of Strand NGS v3.1 at ASHG 2017

ORLANDO, USA, Oct 17, 2017/ PRNewswire/

Strand NGS now supports large scale RNA- and small-RNA-Seq and Unique Molecular Identifiers (UMIs) for DNA-, RNA-, and small-RNA-Seq.

Strand Life Sciences announced the latest version release of its bioinformatics flagship product, Strand NGS, at the Annual Meeting of the American Society of Human Genetics today. Two major themes in Strand NGS v3.1 address recent challenges in next generation sequencing (NGS).

The first theme is large-scale RNA-Seq data analysis. Current cross-cohort RNA- and small-RNA-Seq studies span tens of replicates and batches across hundreds of samples, sometimes conducted across several different institutions. For such studies, Strand NGS v3.1 includes confounding variable analysis to eliminate technical effects, including batch effects; the t-SNE plot; profile and heat-map plots of gene-body coverage; and several other notable visual enhancements.

The second new feature is support for Unique Molecular Identifiers, or UMIs, for DNA-, RNA- and small-RNA-Seq. UMI support in Strand NGS is end-to-end, spanning alignment to variant calling in DNA-Seq, and alignment to quantification in RNA- and small-RNA-Seq. The Bioo Scientific, Qiagen, and Rubicon UMI protocols are natively supported, and an intuitive interface allows the specification of custom UMI protocols.

“For liquid biopsies and low-grade FFPE samples, UMI support in DNA-Seq enables the detection of somatic variants at low concentrations. In RNA-Seq, large-scale and UMI support can be used in single-cell-based studies that reveal tumor-cell heterogeneity, even at low concentrations”, says Dr. Vamsi Veeramachaneni, Chief Scientific Officer, Strand Life Sciences.

“At Strand, we are continuously working towards improving the accuracy and efficiency of NGS data analysis. Customers can look forward to Strand NGS becoming available on the cloud in the near future”, says Dr. Ramesh Hariharan, Chief Executive Officer, Strand Life Sciences.

Visit Strand Life Sciences at ASHG booth #1017 to know more about Strand NGS v3.1 and other products and service offerings from Strand Life Sciences. Click here to access detailed agenda and v3.1 release notes.

About Strand Life Sciences

Strand Life Sciences is a premier life science informatics innovation company. Founded in 2000, Strand is a leader in technology innovations for healthcare using genomics. By enhancing sequence-based diagnostics and clinical genomic data interpretation using a strong foundation of computational, scientific, and medical expertise, Strand is bringing individualized medicine to the world. To know more, visit www.strandls.com

Address of the bookmark: http://www.strand-ngs.com/strand-announce-strandngss-v31

StringTie Transcript assembly and quantification for RNA-Seq

Jit — Tue, 09 Jun 2020 05:21:11 -0500

StringTie is a fast and highly efficient assembler of RNA-Seq alignments into potential transcripts. It uses a novel network flow algorithm as well as an optional de novo assembly step to assemble and quantitate full-length transcripts representing multiple splice variants for each gene locus. Its input can include not only alignments of short reads that can also be used by other transcript assemblers, but also alignments of longer sequences that have been assembled from those reads. In order to identify differentially expressed genes between experiments, StringTie's output can be processed by specialized software like Ballgown, Cuffdiff or other programs (DESeq2, edgeR, etc.).

Address of the bookmark: https://ccb.jhu.edu/software/stringtie/

Exploring RNA Sequence Analysis: Tools for Every Bioinformatician

Neel — Fri, 13 Dec 2024 04:03:04 -0600

RNA sequence analysis has become an essential part of modern biological research. From RNA-seq pipelines to specialized tools for specific RNA types, here's a comprehensive guide to tools you can use to make sense of RNA data.

1. RNA-Seq Analysis Pipelines

RNA-seq is one of the most popular techniques for studying RNA. These tools streamline processing raw sequence data:

FASTQC: For quality control of raw RNA-seq reads.
Trimmomatic: For trimming and filtering RNA-seq reads.
HISAT2/STAR: High-performance aligners for RNA-seq reads.
FeatureCounts: For quantifying gene expression.
DESeq2/EdgeR: For differential expression analysis.

2. Transcriptome Assembly and Annotation

For analyzing transcriptomes from non-model organisms or assembling novel transcripts:

Trinity: For de novo transcriptome assembly.
StringTie: For transcript assembly and quantification from RNA-seq alignments.
TransDecoder: To predict coding regions within assembled transcripts.
TAU: Tools for annotating non-coding and coding RNAs.

3. Exploring Non-Coding RNA (ncRNA)

Non-coding RNAs play critical regulatory roles. Dedicated tools for studying them include:

Infernal: For identifying ncRNA sequences based on covariance models.
Rfam: Database and tools for ncRNA families.
miRDeep: For identifying microRNAs in RNA-seq datasets.

4. RNA Structure and Motif Analysis

Structural biology of RNA helps in understanding its function:

RNAfold (ViennaRNA): Predicts secondary structures from RNA sequences.
RNAstructure: Tools for RNA secondary structure prediction and analysis.
MEME Suite: For identifying motifs in RNA sequences.
IntaRNA: For RNA-RNA interaction prediction.

5. RNA Editing and Modifications

Epitranscriptomics is a growing field focusing on RNA modifications:

REDItools: For RNA editing analysis.
m6Aboost: For identifying m6A modifications in RNA.

6. Long-Read RNA Sequencing Analysis

Long-read technologies like Nanopore and PacBio are transforming RNA research:

FLAIR: For isoform-level analysis of long-read RNA-seq data.
NanoMod: For detecting modifications in RNA from Nanopore sequencing.

7. RNA-Protein Interactions

To study RNA-protein interactions and complexes:

RBPmap: For identifying RNA-binding protein motifs.
PARalyzer: For analyzing PAR-CLIP data.

8. Functional Enrichment Analysis

Understanding biological functions and pathways from RNA-seq data:

getENRICH: A tool designed for pathway enrichment analysis of non-model organisms (hypergeometric P-value calculation with FDR correction).
ClusterProfiler: For GO and KEGG pathway enrichment analysis.

9. Visualization and Data Sharing

Presenting and sharing RNA sequence analysis results effectively:

IGV: Genome browser for visualizing RNA-seq alignments.
Circos: Circular visualization of RNA-seq data.
DashBio: A Python library for creating bioinformatics visualizations.

Conclusion

The bioinformatics landscape for RNA sequence analysis is vast, with tools catering to specific needs. Whether you’re studying coding RNAs, non-coding RNAs, or exploring RNA-protein interactions, the right tools can transform your data into biological insights.

Webinar on RNA-Seq Data Analysis on 28 Feb 2018

Strand — Thu, 22 Feb 2018 06:38:48 -0600

Strand NGS is a biologist friendly NGS analysis tool that allows biologists to analyze their data using a very intuitive workflow for the analysis and visualization of RNA-Seq data. This webinar will give an overview of the workflow which includes Transcriptome/ Genome alignment, Differential expression analysis, Splicing events and gene fusion detection. Strand NGS also supports novel discovery like identification of novel genes, exons and novel splice junctions.
We will highlight the use of Strand NGS features such as PCA, sample correlation, clustering, Venn diagrams, CVA, UMI support and elastic genome browser used in RNA-Seq workflow that supports large scale RNA-Seq data analysis too. The tool also supports biological contextualization on the set of interesting genes from the data by allowing downstream analysis such as GO and pathway analysis. The product has an option to create pipelines for time consuming jobs which automates analysis and leaves more time for end data interpretation. This webinar will give an overview of the features in the RNA-Seq data analysis workflow in Strand NGS.

Details:
Session 1: 28 Feb 2018, 9 AM CET
Session 2: 28 Feb 2018, 8 AM PST
Register here: http://www.strand-ngs.com/webinar_registration

About Speaker:

Dr. Suman Kapoor, Manager- Application Science at Strand Life Sciences, has over 11 years experience in molecular biology, next-generation sequencing based testing, clinical genomics, and personalized medicine for disease management and prenatal testing. Dr. Suman holds a Ph.D in Molecular and Cell Biology from Indian Institute of Science, Bangalore. Prior to joining Strand NGS team, Suman has worked extensively on protein synthesis in eubacteria and has experience working in CAP and NABL accredited lab validating and interpreting NGS based diagnostic tests.

Step-by-Step Guide to Detect piRNAs Using Bioinformatics

Abhi — Fri, 13 Dec 2024 11:41:46 -0600

Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

Obtain RNA Sequencing Data
Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.
Quality Control (QC)
Use FastQC to assess the quality of raw reads:

fastqc reads.fastq

Evaluate the per-base quality, adapter content, and overrepresented sequences.
Trimming and Adapter Removal
Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

Reference Genome Preparation
Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.
Align Reads
Use Bowtie or STAR for small RNA alignment:

bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
- -v 1: Allows one mismatch.
- -k 1: Reports the best alignment.
Convert SAM to BAM
Convert and sort alignments using SAMtools:

samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

Extract Reads by Size
Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq
Check for Sequence Bias
piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

Generate Overlap Statistics
Use the piPipes tool or custom scripts to calculate overlap:

python ping_pong_overlap.py sorted_reads.bam
Visualize Overlap Distribution
Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

Cluster Identification
Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters
Annotate Genomic Regions
Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

Predict piRNA Targets
Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt
Enrichment Analysis
Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

Validate piRNA Candidates
Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.
Visualize Results
- Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
- Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

Archive Data
Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.
Publish Results
Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

SVfinder: Tool for detecting genomic rearrangement form DNA-seq data

Robert M Willioms — Thu, 14 Dec 2017 15:51:40 -0600

SVfinder provides genome-wide detection of structural variants from next generation paired-end sequencing reads.

Address of the bookmark: https://github.com/cauyrd/SVfinder

Papenfuss Lab

Sun, 14 Jul 2013 12:22:28 -0500

The human genome project and similar projects in disease-causing organisms such as Plasmodium falciparum, which causes malaria in humans, have provided new tools for discovery in biology and have accelerated the development of understanding in human disease.

Research Area:
Analysis of Next Generation sequence data in cancer
Methods for analysis of structural variation in cancer genomes
Next Generation sequencing in malaria
Computational comparative genomics
Sensitive genomic sequence search techniques using hidden Markov models
Tasmanian devil facial tumour disease

Link @ http://www.wehi.edu.au/faculty_members/dr_tony_papenfuss

Bioinformatics PhD studentship available in New Zealand

Sun, 14 Jul 2013 13:36:30 -0500

Bioinformatics PhD studentship available in New Zealand

The importance of transcriptional control has been explored in a burgeoning line of research over several decades; nevertheless, we are still far from having a complete picture of the regulatory mechanisms of genes and non-coding RNAs, and their influences on different phenotypes and disease states of a cell. Recent shifts towards large-scale analyses of transcriptional regulation on a sequence and epigenetic level are at the forefront of research, mainly due to sequencing technology advancements and a deeper understanding of the fundamental regulatory processes involved.

Arriving at a better understanding of the influence of specific parts of the overall regulatory machinery on disease states is a high priority of the group’s research agenda.

We are seeking an enthusiastic student to join the group as a PhD student. Applicants must have a BSc(Hons) or MSc degree in a relevant discipline and a willingness to learn and apply new techniques and work in a team. Both local and international students are encouraged to apply.

The studentship covers all university fees and an annual tax-exempt stipend of NZ$22,000 for three years.

Sebastian Schmeier recently joined Massey University and started his own research group in Auckland, New Zealand, a city regularly ranked one of the most livable in the world. This is your chance to experience the amazing Auckland lifestyle and the excitement of joining a young new science team, while staying connected to world class scientific networks.

To apply for the post, please send a cover letter stating your interest in the position and why you think you would be a good candidate, a Curriculum Vitae, a copy of your academic transcript, a sample of your written scientific work, and the names of three referees. Applications will be accepted until the position is filled.

Enquiries and applications to Sebastian Schmeier (s.schmeier@massey.ac.nz).

Phylogenetic for Bioinformatics

Jitendra Narayan — Tue, 16 Jul 2013 03:50:30 -0500

Biologists estimate that there are about 5 to 100 million species of organisms living on Earth today. Evidence from morphological, biochemical, and gene sequence data suggests that all organisms on Earth are genetically related, and the genealogical relationships of living things can be represented by a vast evolutionary tree, the Tree of Life. The Tree of Life then represents the phylogeny of organisms, i. e., the history of organismal lineages as they change through time.
Every living organism contains DNA, RNA, and proteins. Closely related organisms generally have a high degree of agreement in the molecular structure of these substances, while the molecules of organisms distantly related usually show a pattern of dissimilarity. Molecular phylogeny uses such data to build a "relationship tree" that shows the probable evolution of various organisms. Not until recent decades, however, has it been possible to isolate and identify these molecular structures.
phylogenetics is the study of evolutionary relatedness among various groups of organisms (for example, species or populations), which is discovered through molecular sequencing data and morphological data matrices. In other word, Phylogenetics, the science of phylogeny, is one part of the larger field of systematics, which also includes taxonomy. Taxonomy is the science of naming and classifying the diversity of organisms Molecular phylogeny is the use of the structure of molecules to gain information on an organism's evolutionary relationships. The result of a molecular phylogenetic analysis is expressed in a so-called phylogenetic tree.

The evolutionary connections between organisms are represented graphically through phylogenetic trees. Due to the fact that evolution takes place over long periods of time that cannot be observed directly, biologists must reconstruct phylogenies by inferring the evolutionary relationships among present-day organisms.
Application of the techniques that make this possible can be seen in the very limited field of human genetics, such as the ever more popular use of genetic testing to determine a child's paternity, as well as the emergence of a new branch of criminal forensics focused on genetic evidence.
The effect on traditional scientific classification schemes in the biological sciences has been dramatic as well. Work that was once immensely labor- and materials-intensive can now be done quickly and easily, leading to yet another source of information becoming available for systematic and taxonomic appraisal. This particular kind of data has become so popular that taxonomical schemes based solely on molecular data may be encountered. Proponents even claim that taxonomy was previously based on morphology alone, which of course is utter fable.

For additional information on phylogenetics, see list of Phylogenetics Resources on the Internet.

Phylogeny and Reconstructing Phylogenetic Trees: http://aleph0.clarku.edu/~djoyce/java/Phyltree/cover.html
the CBRG and Department of Statistics Phylogeny tutorial: http://www.compbio.ox.ac.uk/tutorials/phylogeny/
TUTORIAL: PHYLOGENETIC ANALYSIS USING PARSIMONY:http://home.cc.umanitoba.ca/~psgendb/GDE/phylogeny/parsimony/phylip.parsimony.html

PHYLIP: http://www.umanitoba.ca/afs/plant_science/psgendb/doc/Phylip/main.html
An Introduction to Molecular Phylogeny: http://bibiserv.techfak.uni-bielefeld.de/gcb04/tutorials/hoef-emden/GCB04Tut.pdf

How to make a phylogenetic tree: http://www.hiv.lanl.gov/content/sequence/TUTORIALS/TREE_TUTORIAL/Treetutorial.html
Phylogenetic Trees: http://cnx.org/content/m11052/latest/
Phylogeny by Ron Shamir: http://www.cs.tau.ac.il/~rshamir/algmb/01/scribe08/lec08.pdf
Introduction to Phylogeny: http://www.utm.edu/departments/cens/biology/rirwin/391/391Phylog.htm
Lecturer notes on Phylogeny: http://www.sbc.su.se/~bens/course_material/phylocourse1/lecture2.pdf
Principles and Practice of Phylogenetic Systematics:http://www.faculty.biol.ttu.edu/Strauss/Phylogenetics/LectureNotes.htm

Inferring phylogenetic trees: http://www.cis.hut.fi/Opinnot/T-61.6070/slides2008/pres_6070.pdf

Lecture Notes

Chapter 1 - The Diversity, Classification, and Evolution of Vertebrates:http://academic.emporia.edu/mooredwi/nathist/chap1.htm

Algorithms for Phylogenetic Reconstructions:http://lectures.molgen.mpg.de/Algorithmische_Bioinformatik_WS0405/phylogeny_script.pdf

Phylogeny.fr is a free, simple to use web service dedicated to reconstructing and analysing phylogenetic relationships between molecular sequences. Phylogeny.fr runs and connects various bioinformatics programs to reconstruct a robust phylogenetic tree from a set of sequences. For more detail : http://www.phylogeny.fr/version2_cgi/index.cgi

A Brief Tutorial on Phylogenetics
http://bioss.ac.uk/~dirk/talks/tutorial_phylogenetics.pdf

A Brief Tutorial on Phylogenetics Human Rabbit Chicken
http://bioss.ac.uk/~dirk/talks/psnup_tutorial_phylogenetics.pdf

Phylogenetic Tree Computation Tutorial Overview
http://pga.lbl.gov/Workshop/April2002/lectures/Olken.pdf

MrBayes: A program for the Bayesian inference of phylogeny
http://golab.unl.edu/teaching/SBseminar/manual.pdf

Web sites providing software for the construction of phylogenetic trees